C2 (NM_000063) Human 3' UTR Clone

CAT#: SC204602

3' UTR clone of complement component 2 (C2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C2 (NM_000063) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARMD14; CO2
ACCN NM_000063
Insert Size 345 bp
Sequence Data
>SC204602 3’UTR clone of NM_000063
The sequence shown below is from the reference sequence of NM_000063. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGATGTCCTGAATTTTTTACCCCTCTAGCCATGGCCACTGAGCCCTCTGCTGCCCTGCCAGAATCTG
CCGCCCCTCCATCTTCTACCTCTGAATGGCCACCCTTAGACCCTGTGATCCATCCTCTCTCCTAGCTGA
GTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAG
CAGGACTGCCTCGCTGCCCCACCTCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGA
CTCATGCTTGTTTCACTTTCACATGGAATTTCCCAGTTATGAAATTAATAAAAATCAATGGTTTCCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000063.6
Synonyms ARMD14; CO2
Summary Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]
Locus ID 717
MW 12.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...