NXF1 (NM_006362) Human 3' UTR Clone

CAT#: SC204700

3' UTR clone of nuclear RNA export factor 1 (NXF1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NXF1 (NM_006362) Human 3' UTR Clone
Vector pMirTarget
Synonyms MEX67; TAP
ACCN NM_006362
Insert Size 376 bp
Sequence Data
>SC204700 3’UTR clone of NM_006362
The sequence shown below is from the reference sequence of NM_006362. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGATCCCAGAAGTGGCATTCATGAAGTGATCGTAGTCATGCCTCAGAAGCAGTCCCCCCTGTAAATAG
TCCTTGGATATTACCGTCTGGTTGTCGTCTGTCATCTCCTCCTGTCTGGCCCGAGGCCGCCCCGTGACT
GTGACCGAGGGAGGGAGGGCTGCCTGATCCCTCTCCTCGCCTGCCTTCTGGAAGACTTCAGAAGATTGA
GCCTCACTGGTGCCAGGAAGCCAAAGCTTACTTTGTAGAACTGACACTAAACTACCCGAAGGACTTAGG
TGCTTTGTGTACTTAACCCCAGGACCTCCTTACTTTTTAATATAAAGAGTGATGTTGTATTTCGTGTTC
TGCACTTTTTAATATAAAGAGTGATGTTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006362.5
Synonyms MEX67; TAP
Summary This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Locus ID 10482
MW 13.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...