Bestrophin (BEST1) (NM_004183) Human 3' UTR Clone

CAT#: SC204730

3' UTR clone of bestrophin 1 (BEST1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Bestrophin (BEST1) (NM_004183) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARB; BEST; Best1V1Delta2; BMD; RP50; TU15B; VMD2
ACCN NM_004183
Insert Size 369 bp
Sequence Data
>SC204730 3’UTR clone of NM_004183
The sequence shown below is from the reference sequence of NM_004183. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGAAAACAGGGATGAAGCACATTCCTAACCTGCTTCCTAATGGGGATGCTTCGCCAGCCAGGTCCTC
ACCTGTGTGTACACCAGCAGGACACTGATCCAGTCACAGCCATACAGCTGTCCACACTGAAGAACATGT
CCTACAACAGCCTGAATCAAATGGTTAGCTTAATAGATAAAAATCCCAGACTACTTCAGCCTTTAATGC
CTTTTATTCATAAAAACTGTGAAAGCTAGACTGAACCATTGGAAACATTTAACTCAGACTCTGGATTCA
GAGTCGGGAACCCTTAGTTCTATCTGAATCCAAGACAGCCACACCTTAGTATACTGCCCAAACTAATGA
GTTTAATAAATACAAATACTCGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004183.4
Synonyms ARB; BEST; Best1V1Delta2; BMD; RP50; TU15B; VMD2
Summary This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
Locus ID 7439
MW 14
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...