DCTN1 (NM_023019) Human 3' UTR Clone

CAT#: SC204846

3' UTR clone of dynactin 1 (p150 glued homolog Drosophila) (DCTN1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DCTN1 (NM_023019) Human 3' UTR Clone
Vector pMirTarget
Synonyms DAP-150; DP-150; P135
ACCN NM_023019
Insert Size 374 bp
Sequence Data
>SC204846 3’UTR clone of NM_023019
The sequence shown below is from the reference sequence of NM_023019. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCAGCTTCACAGTCGCCTCATCTCCTAAGCACTCCTTTCCCCTGCTGTCCCCTTCGACCCTCAGCCC
TCTGGTGCCGCTCTGCCCGATGCACAGCCACCTCAGCCAGCCCCCAGGTAGAAACGTGGGTTAAGCTCT
TCCTGCCCCGTTCAGCTTCACTCCCACCCTTTCAGCGTCCTGCCCCTTCACCTTGACCCGGGTTCCCCC
ACTCCCATTCCCTGGCCTCTGCCATAATTTGTTGTTCAACTGCTCCCTCCTTCCTGAGGGGCCTCAGGG
CTTGTGGGGGGTAGGCTGAGACCCCACCACCAAAGGTTAAGTGAGGTCCCCTTGATTGAGGACTTCACC
CCTTGATTAAAGCAACTTCTGCTTCAGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_023019.4
Synonyms DAP-150; DP-150; P135
Summary This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
Locus ID 1639
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...