MASP2 (NM_006610) Human 3' UTR Clone

CAT#: SC205081

3' UTR clone of mannan-binding lectin serine peptidase 2 (MASP2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MASP2 (NM_006610) Human 3' UTR Clone
Vector pMirTarget
Synonyms MAP-2; MAP19; MASP-2; MASP1P1; sMAP
ACCN NM_006610
Insert Size 392 bp
Sequence Data
>SC205081 3’UTR clone of NM_006610
The sequence shown below is from the reference sequence of NM_006610. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGATCGAGAACATAATTAGTGATTTTTAACTTGCGTGTCTGCAGTCAAGGATTCTTCATTTTTAGAAA
TGCCTGTGAAGACCTTGGCAGCGACGTGGCTCGAGAAGCATTCATCATTACTGTGGACATGGCAGTTGT
TGCTCCACCCAAAAAAACAGACTCCAGGTGAGGCTGCTGTCATTTCTCCACTTGCCAGTTTAATTCCAG
CCTTACCCATTGACTCAAGGGGACATAAACCACGAGAGTGACAGTCATCTTTGCCCACCCAGTGTAATG
TCACTGCTCAAATTACATTTCATTACCTTAAAAAGCCAGTCTCTTTTCATACTGGCTGTTGGCATTTCT
GTAAACTGCCTGTCCATGCTCTTTGTTTTTAAACTTGTTCTTATTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006610.4
Synonyms MAP-2; MAP19; MASP-2; MASP1P1; sMAP
Summary This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Locus ID 10747
MW 15
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...