Glutathione Synthetase (GSS) (NM_000178) Human 3' UTR Clone

CAT#: SC205551

3' UTR clone of glutathione synthetase (GSS) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Glutathione Synthetase (GSS) (NM_000178) Human 3' UTR Clone
Vector pMirTarget
Synonyms GSHS; HEL-S-64p; HEL-S-88n
ACCN NM_000178
Insert Size 403 bp
Sequence Data
>SC205551 3' UTR clone of NM_000178
The sequence shown below is from the reference sequence of NM_000178. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTGGCAGTCCTGGACAACCCATACCCTGTGTGAGGGCACAACCAGGCCACGGGACCTTCTATCCTCTGT
ATTTGTCATTCCTCTCCTAGCCCTCCTGAGGGGTATCCTCCTAAAGACCTCCAAAGTTTTTATGGAAGGG
TAAATACTGGTACCTTCCCCCAGCTTTCCATCTGAGGACCAGAAAAGTTGTGTCTCCCTTAGATGAGATC
TAGACGCCCCCAAATCCTTGAGATGTGGGTATAGCTCAGGGTAAGCTGCTCTGAGGTAAAGGTCCATGAA
CCCTGCCCCACTCCTGTCAGCCCCTCATCAGCCTTTTCAGCAGGTTCCAGTGCCTGACTTGGGATAGGAC
TGAGTGGTAGGAGGAGGGGGAGTGGAGGGGCATAGCCTTTCCCTAATTCTGCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000178.2
Synonyms GSHS; HEL-S-64p; HEL-S-88n
Summary Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
Locus ID 2937
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...