MSK1 (RPS6KA5) (NM_182398) Human 3' UTR Clone

CAT#: SC206470

3' UTR clone of ribosomal protein S6 kinase 90kDa polypeptide 5 (RPS6KA5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MSK1 (RPS6KA5) (NM_182398) Human 3' UTR Clone
Vector pMirTarget
Synonyms MSK1; MSPK1; RLPK
ACCN NM_182398
Insert Size 471 bp
Sequence Data
>SC206470 3’UTR clone of NM_182398
The sequence shown below is from the reference sequence of NM_182398. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCACAGGGATCTGAAACCTGAGGTATAAAATCACTGGATCTCTTACGTAATTCAGTCTAGCACCATT
ATTAAAGATCTCCCAAACATGGGGGAAGTTTCTGGGGAGGTTTCCTTATTTTTTTACTTTTCAAGGCTG
TTAAATAGATAATTGAAAATACGTTTCTTTGATGTTTTTTCTTTTATATTTCAGTCTAAAATAAATTTG
TCTTTGTTTATTTTTTGCCAGCTGATCATCTTGAGGTTATATTTGTAAGTGTGAGAACCTTTTATGGAA
AAAATACTTTATGCAACAGTTGTGGACTAAAAATAGCAATGGAAATTTTTATAGCAGAAAATAATATCT
CTTACATATAATTTTAGAGGGTTTTTTTTCCAAATGATGTATTTTGAAAACTTATTTTTTACATTTGTA
ATCAAATTGGTTAGCTCATGAATAAAAATGTATATAATTCTATTCTAAATACTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182398.3
Synonyms MSK1; MSPK1; RLPK
Summary Serine/threonine-protein kinase that is required for the mitogen or stress-induced phosphorylation of the transcription factors CREB1 and ATF1 and for the regulation of the transcription factors RELA, STAT3 and ETV1/ER81, and that contributes to gene activation by histone phosphorylation and functions in the regulation of inflammatory genes (PubMed:11909979, PubMed:12569367, PubMed:12763138, PubMed:9687510, PubMed:18511904, PubMed:9873047). Phosphorylates CREB1 and ATF1 in response to mitogenic or stress stimuli such as UV-C irradiation, epidermal growth factor (EGF) and anisomycin (PubMed:11909979, PubMed:9873047). Plays an essential role in the control of RELA transcriptional activity in response to TNF and upon glucocorticoid, associates in the cytoplasm with the glucocorticoid receptor NR3C1 and contributes to RELA inhibition and repression of inflammatory gene expression (PubMed:12628924, PubMed:18511904). In skeletal myoblasts is required for phosphorylation of RELA at 'Ser-276' during oxidative stress (PubMed:12628924). In erythropoietin-stimulated cells, is necessary for the 'Ser-727' phosphorylation of STAT3 and regulation of its transcriptional potential (PubMed:12763138). Phosphorylates ETV1/ER81 at 'Ser-191' and 'Ser-216', and thereby regulates its ability to stimulate transcription, which may be important during development and breast tumor formation (PubMed:12569367). Directly represses transcription via phosphorylation of 'Ser-1' of histone H2A (PubMed:15010469). Phosphorylates 'Ser-10' of histone H3 in response to mitogenics, stress stimuli and EGF, which results in the transcriptional activation of several immediate early genes, including proto-oncogenes c-fos/FOS and c-jun/JUN (PubMed:12773393). May also phosphorylate 'Ser-28' of histone H3 (PubMed:12773393). Mediates the mitogen- and stress-induced phosphorylation of high mobility group protein 1 (HMGN1/HMG14) (PubMed:12773393). In lipopolysaccharide-stimulated primary macrophages, acts downstream of the Toll-like receptor TLR4 to limit the production of pro-inflammatory cytokines (By similarity). Functions probably by inducing transcription of the MAP kinase phosphatase DUSP1 and the anti-inflammatory cytokine interleukin 10 (IL10), via CREB1 and ATF1 transcription factors (By similarity). Plays a role in neuronal cell death by mediating the downstream effects of excitotoxic injury (By similarity). Phosphorylates TRIM7 at 'Ser-107' in response to growth factor signaling via the MEK/ERK pathway, thereby stimulating its ubiquitin ligase activity (PubMed:25851810).[UniProtKB/Swiss-Prot Function]
Locus ID 9252
MW 19
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...