ATP6V0C (NM_001694) Human 3' UTR Clone

CAT#: SC206825

3' UTR clone of ATPase H+ transporting lysosomal 16kDa V0 subunit c (ATP6V0C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP6V0C (NM_001694) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP6C; ATP6L; ATPL; VATL; Vma3; VPPC
ACCN NM_001694
Insert Size 503 bp
Sequence Data
>SC206825 3’UTR clone of NM_001694
The sequence shown below is from the reference sequence of NM_001694. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGAATATTATGTAAA
GACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCCCCCAGTAGTTG
GTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGCCCGCCCCGTG
CCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAGTGCTCTGTG
TATGCGGATGATTTAGAATTGTCATTTCTCTTTACTGGATGTTTATTTATAAAGATCTGGCCTGTTCCT
GCGTCTGCGGAGCGGCCCTTGTCTCCCAGCTATCTATAACCTTAGCTAGAGTGTCGCCTTGTGGGTTCC
TGTTGCTGAGACTTCCTGGATGGAGCCGCCCTCACCGCCGGGCCCGTGGCCCTGCGCGGAGCTGTGTCC
AATAAAGTTCTTGGATGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001694.4
Synonyms ATP6C; ATP6L; ATPL; VATL; Vma3; VPPC
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010]
Locus ID 527
MW 18.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...