Metabotropic Glutamate Receptor 8 (GRM8) (NM_000845) Human 3' UTR Clone

CAT#: SC207171

3' UTR clone of glutamate receptor metabotropic 8 (GRM8) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Metabotropic Glutamate Receptor 8 (GRM8) (NM_000845) Human 3' UTR Clone
Vector pMirTarget
Synonyms GLUR8; GPRC1H; mGlu8; MGLUR8
ACCN NM_000845
Insert Size 551 bp
Sequence Data
>SC207171 3’UTR clone of NM_000845
The sequence shown below is from the reference sequence of NM_000845. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATATCAGTTACAGCAATCATTCAATCTGAAACAGGGAAATGGCACAATCTGAAGAGATGTGGTATATG
ATCTTAAATGATGAACATGAGACCGCAAAAATTCACTCCTGGAGATCTCCGTAGACTACAATCAATCAA
ATCAATAGTCAGTCTTGTAAGGAACAAAAATTAGCCATGAGCCAAAAGTATCAATAAACGGGGAGTGAA
GAAACCCGTTTTATACAATAAAACCAATGAGTGTCAAGCTAAAGTATTGCTTATTCATGAGCAGTTAAA
ACAAATCACAAAAGGAAAACTAATGTTAGCTCGTGAAAAAAAATGCTGTTGAAATAAATAATGTCTGAT
GTTATTCTTGTATTTTTCTGTGATTGTGAGAACTCCCGTTCCTGTCCCACATTGTTTAACTTGTATAAG
ACAATGAGTCTGTTTCTTGTAATGGCTGACCAGATTGAAGCCCTGGGTTGTGCTAAAAATAAATGCAAT
GATTGATGCATGCAATTTTTTATACAAATAATTTATTTCTAATAATAAAGGAATGTTTTGCAAATGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000845.3
Synonyms GLUR8; GPRC1H; mGlu8; MGLUR8
Summary L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2918
MW 21.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Metabotropic Glutamate Receptor 8产品

Customer Reviews 
Loading...