RPA34 (RPA2) (NM_002946) Human 3' UTR Clone

CAT#: SC208438

3' UTR clone of replication protein A2 32kDa (RPA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPA34 (RPA2) (NM_002946) Human 3' UTR Clone
Vector pMirTarget
Synonyms REPA2; RP-A p32; RP-A p34; RPA32
ACCN NM_002946
Insert Size 669 bp
Sequence Data
>SC208438 3’UTR clone of NM_002946
The sequence shown below is from the reference sequence of NM_002946. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCATTTTAAATCCACAGATGCAGAATAACTGGATCTAACTGGGTACCTGAGATATTTTACAGCTGGA
CCTAGTTTCACAATCTGTTGTCTCCAGCTCTGCATATGTCTGGCCAGGGGGCTTCTAGGAAGTAGGTTT
CATCTATCAAATGTCTCCTCTGACTTCCTTTTGAAACTTACTGCTCTTCTGTTTTATTTTGTTTTGTTT
GAAGCTCAGAGGGAGATGGGCAATTGACAGGGATGCAATCCAGGGTGGGATTTCTTGAGGAAGTTACAA
ATAAGCTTGTTACAACATCAAGATAGATGGAATTGGAAGGATGCTACCAGGAGAGTACTTACATAGTGC
TCAGGAGTTTCTCTTCTTAAAATGTTTACTGCTGAAAGATGAGCAGGACCAGGGCGTTATAGGCAGAGC
CCTAGCCGAGAAACCTGCTGGCCTCTGCCTGTTTTCATTTCCCACTTTGGTTGTGTGGCATTACTTTCA
GAATTGCACTTTCCTGCTTGTCATGACTTTTTGACACACTTGCCATGACGTGTGTTTCTGTGAACATGA
AGTTCTGCGGTAGTGCCTCCAGGGGCAGAGGAAAAGAAGAAGTGTTACTGCATTTTGTACAAAATAAAT
ACAGTCATATGTTTAATAAAACAGTTCTATTGTAGTAACTTGTAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002946.5
Synonyms REPA2; RP-A p32; RP-A p34; RPA32
Summary This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017]
Locus ID 6118
MW 25.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...