Anapc15 (NM_027532) Mouse Untagged Clone
CAT＃: MC200398
Anapc15 (untagged) - Mouse RIKEN cDNA 3200002M19 gene (3200002M19Rik), (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 3200002M19Rik; 6330414C15Rik; APC15 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC006736 sequence for NM_027532
CTGGAACTATGTGTGGGAGGCTGGAAGAGAACATCACCTTCTCTGGATCTGGAGTTGCAGATGGTTGTGA AATGCACGATGAGGAAACTGAGGCCCAGAGAGGTTAAGTGTATTGGCCAAAATCAAAGAGCTAGTAAGTG ATGGAGCCAGGACTCAAACTCAGCTTAGGAGCCATGTCCACCTTGTTCCCGTCACTCTTCCCTCGTGTGA CTGAGACACTGTGGTTTAATCTGGACCGACCCTGTGTGGAGGAGACAGAGCTGCAGCAGCAGGAGCAGCA GCATCAGGCCTGGCTCCAAAGCATCGCAGAGAAAGACAACAACCTGGTACCAATTGGCAAGCCGGCCTCA GAGCACTACGATGATGAGGAAGAAGAGGATGATGAAGATGATGAGGACAGTGAAGAGGATTCCGAAGATG ATGAGGACATGCAAGACATGGATGAGATGAATGACTATAATGAGTCACCTGATGATGGAGAGGTCAATGA GGTGGACATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAGGTAGACAAGCCAAGGTGGCCT CAGTGATTCCAGACCACCCCAACCTATTTTGAATCTACAGCCTCAGCCCCTCAGCCTGCAGAACCAGCTT GTGGCTGTAGTGCCTAAAGCTTTCCCTTAGGCACTTTCTCAGCTACTGCCAGGACAAGGTCTCCTTGGGC CCTTCCAGGCCATGAGTCTTCCCTTGAATCCCAAGAGCCTGAGCCCATCCCACCTTCCTGGCTGGTACCT CACTCCTTGGTTGCCAGGTGTGGTCCCTTTCTAGCCCTCTTTAATAAAGACACAGGACTGATTGTTTCCC CAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_027532 |
| Insert Size | 399 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC006736, AAH06736 |
| RefSeq Size | 863 bp |
| RefSeq ORF | 399 bp |
| Locus ID | 75430 |
| UniProt ID | P60007 |
| Gene Summary | Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice junction at the 3' end of one exon and at the 5' end of the next exon compared to variant 1. The resulting isoform (c) has a shorter and distinct N-terminus compared to isoform a. Variants 3, 4, and 5 all encode the same isoform (c). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200760 | Anapc15 (tGFP-tagged) - Mouse RIKEN cDNA 3200002M19 gene (3200002M19Rik) |
CNY 2850.00 |
|
| MR200760 | Anapc15 (Myc-DDK-tagged) - Mouse RIKEN cDNA 3200002M19 gene (3200002M19Rik) |
CNY 1200.00 |
|
| MR200760L3 | Lenti ORF clone of Anapc15 (Myc-DDK-tagged) - Mouse RIKEN cDNA 3200002M19 gene (3200002M19Rik) |
CNY 4750.00 |
|
| MR200760L4 | Lenti ORF clone of Anapc15 (mGFP-tagged) - Mouse RIKEN cDNA 3200002M19 gene (3200002M19Rik) |
CNY 4750.00 |
其它Anapc15产品
