Ndufa2 (NM_010885) Mouse Untagged Clone

CAT#: MC200552

Ndufa2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_010885" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AV000592; B8; C1-B8; CI-B8
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC006815 sequence for NM_010885
CAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCA CTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGGGATTTCATCGTGCAACGGTACGTGGAGCTGAAG AAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCT ATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCA GAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGG ACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGAAAAAAAAA AAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010885
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC006815, AAH06815
RefSeq Size 426 bp
RefSeq ORF 300 bp
Locus ID 17991
UniProt ID Q9CQ75
Gene Summary This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. The human ortholog of this gene has been characterized, and its structure and redox potential is reported to be similar to that of thioredoxins. It may be involved in regulating complex I activity or assembly via assistance in redox processes. In humans, mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. A pseudogene of this gene is located on chromosome 5. [provided by RefSeq, May 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...