Polr1d (NM_181730) Mouse Untagged Clone
CAT#: MC201795
Polr1d (untagged) - Mouse polymerase (RNA) I polypeptide D (Polr1d), transcript variant 2, (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 16kD; 1110003G10Rik; AC19; mRP; RPA16; Rpo; Rpo1-3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024394 sequence for NM_181730
CCCGCACCTTTCGCGACATGGGGAAGAGCCTCCATTTCGCCAGCGCCACCTGAGGATTTCCTGGAGCCGC CACCCCCACCTCCCGCGATGGAAGACGATCAGGAGCTGGAGAGGAAAGCCATAGAGGAATTGCTAAAGGA GGCAAAGCGTGGGAAAACCAGAGCGGAGACAATGGGGCCGATGGGCTGGATGAAGTGTCCTCTTGCTGGT ACAAATAAAAGATTCCTAATTAACACAATTAAGAACACACTGCCCTCCCATAAAGAGCAAGACCATGAAC AAAAAGAGGGCAGTAAGGAGCCTGGCAAAAGCCAAGACCAGAAGGAAGCAAGTGGGAAGAAATACCGAAG TCACTCGTACAAGCGCAGCCTTCACTCGTCCCGGGGCTCCGCAGGCTGCTCTCCTCCACGGAAGCGGACC TCCCGGACCTCCGGGGACAAGTGCGACCCACGGCCCAGCAGGCGATGAGACAGCCGCAGGGCTAGCCCAG CCCAGCACTGCACCTGCCACTGAGCGAAGCAAGGAAGACAGGGAGGTGGCCGGCTGGCACCTGAGAGTGA CTTTCTCAGTGGGTCCTTTGTTTTAAGGAGGCTGTTGGTACTGTGTGGTTGTTCTTGTTGCTGTTGTTGT TGTTGTTAACGGGAGAAGAAAACTTTACTAAAACAAATCTTAACTACCTTATCCTGAAGGTGTCGCGGTG AGAGCAAGCTGACTCGGCATGGCCCCCGCATATCCGTGGTGTCTTTATCCTACCTTACTTGGAAGTTCGT TTCAAAACAGGCAGTTTTAGAATTTGAGATTTTGAGATTGTTTAAAAACTCCTAGTTTTTTGATGTACTG CTCTTTTGTGGTCATTTCCCAGAATTTCTCAAAAAAATCAATAAAATACTTAGAAACGCGAAAAAAAAAA AAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_181730 |
Insert Size | 381 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024394, AAH24394 |
RefSeq Size | 919 bp |
RefSeq ORF | 381 bp |
Locus ID | 20018 |
Gene Summary | This gene encodes an RNA polymerase subunit that is a component of both the RNA polymerase I and RNA polymerase III complexes. RNA polymerase I is associated with transcription of pre-ribosomal RNAs, while RNA polymerase III is associated with transcription of small RNAs. Pseudogenes of this gene have been defined on chromosomes 4 and 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200671 | Polr1d (tGFP-tagged) - Mouse RNA polymerase 1-3 (Rpo1-3), transcript variant 2 |
CNY 2850.00 |
|
MR200671 | Polr1d (Myc-DDK-tagged) - Mouse polymerase (RNA) I polypeptide D (Polr1d), transcript variant 2 |
CNY 1200.00 |
|
MR200671L3 | Lenti ORF clone of Polr1d (Myc-DDK-tagged) - Mouse polymerase (RNA) I polypeptide D (Polr1d), transcript variant 2 |
CNY 4750.00 |
|
MR200671L4 | Lenti ORF clone of Polr1d (mGFP-tagged) - Mouse polymerase (RNA) I polypeptide D (Polr1d), transcript variant 2 |
CNY 4750.00 |