C1qtnf5 (NM_001040632) Mouse Untagged Clone
CAT#: MC202206
C1qtnf5 (untagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2, (10ug)
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Adie; CTR; Ctrp5; Mfrp |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025174 sequence for NM_001040632
GGAGCCAGCAAGGAGCAACCAGAAGCTAGGAGTCAGTCAGCAAGGACAGGGGCTGCCTGCCTACAGACTA CAAGAGAGGTTCCTGGAGTCTGAGCCTCCGGGGTCACCACCATGAGGCCACTTCTTGCCCTTCTGCTTCT GGGTCTGGTGTCAGGCTCTCCTCCTCTGGACGACAACAAGATCCCCAGCCTGTGTCCCGGGCAGCCCGGC CTTCCAGGCACACCAGGTCACCATGGCAGCCAAGGCCTGCCTGGCCGTGACGGCCGTGATGGCCGCGACG GTGCACCCGGAGCCCCGGGAGAGAAAGGCGAGGGCGGGAGACCGGGACTACCTGGGCCACGTGGGGAGCC CGGGCCGCGTGGAGAGGCAGGGCCCATGGGGGCTATCGGGCCTGCGGGGGAGTGCTCGGTACCCCCACGA TCAGCCTTCAGTGCCAAGCGATCCGAGAGCCGGGTACCTCCGCCAGCCGACACACCCCTACCTTTCGACC GTGTGCTGCTAAATGAGCAGGGCCATTTCGACCCCACTACTGGCAAGTTCACCTGCCAAGTGCCTGGCGT CTACTACTTTGCTGTGCACGCCACTGTCTACCGGGCCAGCTTGCAGTTTGATCTTGTCAAAAACGGGCAG TCCATCGCCTCTTTCTTCCAGTATTTTGGGGGGTGGCCCAAGCCAGCCTCGCTCTCAGGGGGTGCGATGG TAAGGCTAGAACCTGAGGACCAGGTGTGGGTGCAGGTGGGCGTGGGTGATTACATTGGCATCTATGCCAG CATCAAGACAGACAGTACCTTCTCTGGATTTCTCGTCTATTCTGACTGGCACAGCTCCCCAGTCTTCGCT TAAAACACAGTGAACCCGGAGCTGGCACTTGCTCCTCAGTGGAGGGTGTGACACTAACCCGCGCAGCGCA TACCAGGAGGGCTGGCCCCCTGGAATATTGTGAATGACTTAGGAAGAGAGGGAGCCACTTCCGGTCCCAC TGCTGGCAATGAATGGAGACAGGCTGTCTGAGGTCAAGACAGCGTGGAGCAGTGGCTGGGTTTCTGCCCA GGACTTTAGAATGCAGTAGGCTGGCAGCTGTGGGTCCTGGCCCAGGACTCCAAGGTGGGATGCTCCATTC CTAGTCCTGTGCCCCCTCTAGGTCCCTGACTCCATCTCTGCTGCTCCCAGGGCAGGCCTTTTTCTCAGAG GTCACTTAATAAACCTAAAATCCTCAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_001040632 |
Insert Size | 732 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC025174, AAH25174 |
RefSeq Size | 1234 bp |
RefSeq ORF | 732 bp |
Locus ID | 235312 |
UniProt ID | Q8K479 |
Gene Summary | The protein encoded by this gene is a member of the C1q/tumor necrosis factor superfamily. This family member is a secretory protein that functions in eye development. Mutations in this gene are thought to underlie the pathophysiology of late-onset retinal degeneration (L-ORD) and early-onset long anterior zonules (LAZ). Bicistronic transcripts composed of the coding sequences for this gene (C1qtnf5) and the membrane-type frizzled-related protein gene (Mfrp) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. This variant is represented as monocistronic and may not be 5'-complete; it is unclear if it exists in bicistronic form with the Mfrp ORF, or if it is derived from an internal promoter. Variants 1-5 encode the same C1qtnf5 protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203025 | C1qtnf5 (tGFP-tagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2 |
CNY 2850.00 |
|
MG221727 | C1qtnf5 (tGFP-tagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5) transcript variant 2, (10ug) |
CNY 2850.00 |
|
MR221727 | C1qtnf5 (Myc-DDK-tagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2 |
CNY 2400.00 |
|
MR221727L3 | Lenti ORF clone of C1qtnf5 (Myc-DDK-tagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2 |
CNY 4750.00 |
|
MR221727L4 | Lenti ORF clone of C1qtnf5 (mGFP-tagged) - Mouse C1q and tumor necrosis factor related protein 5 (C1qtnf5), transcript variant 2 |
CNY 4750.00 |
其它C1qtnf5产品