Ube2m (NM_145578) Mouse Untagged Clone
CAT#: MC202916
Ube2m (untagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2510040H03Rik; Ubc-rs2; UBC12 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021792 sequence for NM_145578
CCGAGGATCGCCGAGTCCTCCCGAGCACCTCCGAACACACCCGAGGTGCTTAGCCAGGCCAGAGCCGGAC TACGGGAGCCGAGGCGGGCCGTGCGGTGGGCGCGGAGCAGCGCGGCAGGCCGGGCGAGCGGCAGCGGAGG AGGCCGCGGTAGCGGGTCCGAGGAGCGGAAGCGGCGCAGGCGGCGGCGGGGGGCCGGGTGGCCGGGGTCC CGGGCCCCGCGGCGGCGGCTGCGGCGGCGGCGGCAGGATGATCAAGCTGTTCTCGCTGAAGCAGCAGAAG AAGGAGGAGGAGTCGGCCGGCGGCACCAAGGGCAGCAGCAAGAAGGCGTCGGCGGCGCAGCTCCGGATTC AGAAGGACATTAACGAGCTGAACCTGCCCAAGACGTGTGACATCAGCTTCTCAGACCCAGACGACCTCCT CAACTTCAAGCTGGTGATCTGTCCTGATGAAGGCTTCTACAAAAGTGGCAAGTTTGTATTCAGCTTTAAG GTGGGACAGGGTTACCCACATGACCCTCCCAAGGTGAAGTGTGAAACAATGGTTTATCATCCCAACATTG ACCTCGAGGGCAACGTCTGCCTCAACATCCTCAGAGAGGACTGGAAGCCAGTCCTTACGATAAACTCCAT AATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCCTGAGGACCCACTGAACAAGGAGGCTGCTGAG GTCCTGCAGAACAACCGGCGGCTGTTTGAACAAAATGTGCAGCGCTCCATGAGAGGTGGTTACATCGGGT CCACCTACTTCGAGCGCTGCCTGAAATAGGGTTAGCAATTACCCATCCCTGCCAGGGTTACCGGCCCAGG CATCCCCTGCAAATATTTATTGGGGGCCCGGGTAAGGTGTGTGGGGTAGCCTTGGCCCCTGCCTTGGCCT TGCCTCTCTTCCCTGTCACCTGCCCCTAGTTATTTTTTTTTTTGACCACCACGTGATTATGGTCGGTGCT GCCTCCCCCCCGACCTGCTCAGCGATGGGAAATGAATTGGCTTGTTTAGCGCCCCCCCCCTCCCGCTGGG TGCTGTCCAACTCCCCACTCTTGACTGTGGGGTAAGTGGGCAATGGGCCTGGGTCGCTAGGCCCAAGCAA CCCACCCCACCACCACTGGAGGTCCCACCAGGCTATTAAAGGGGAATGTTACTGCAAAAAAAAAAAAAAA AAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_145578 |
Insert Size | 552 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC021792, AAH21792 |
RefSeq Size | 1199 bp |
RefSeq ORF | 552 bp |
Locus ID | 22192 |
UniProt ID | P61082 |
Gene Summary | Accepts the ubiquitin-like protein NEDD8 from the UBA3-NAE1 E1 complex and catalyzes its covalent attachment to other proteins. The specific interaction with the E3 ubiquitin ligase RBX1, but not RBX2, suggests that the RBX1-UBE2M complex neddylates specific target proteins, such as CUL1, CUL2, CUL3 and CUL4. Involved in cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201663 | Ube2m (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m) |
CNY 2850.00 |
|
MG221562 | Ube2m (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog yeast) (Ube2m) transcript variant 1, (10ug) |
CNY 2090.00 |
|
MR221562 | Ube2m (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1 |
CNY 1900.00 |
|
MR221562L3 | Lenti ORF clone of Ube2m (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1 |
CNY 3800.00 |
|
MR221562L4 | Lenti ORF clone of Ube2m (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1 |
CNY 3800.00 |