Reg3g (NM_011260) Mouse Untagged Clone
CAT＃: MC204993
Reg3g (untagged) - Mouse regenerating islet-derived 3 gamma (Reg3g), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI449515; REG-3-gamma; reg III-gamma |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC061139
ACCATCCTAGGGATCTGCAAGACAGACAAGATGCTTCCCCGTATAACCATCACCATCATGTCCTGGATGC TGCTCTCCTGCCTGATGCTCCTTTCTCAGGTGCAAGGTGAAGTTGCCAAGAAAGATGCCCCATCTTCACG TAGCAGCTGCCCCAAGGGCTCCCGTGCCTATGGCTCCTATTGCTATGCCTTGTTTAGTGTATCTAAAAAC TGGTATGATGCAGATATGGCCTGCCAAAAGAGGCCCTCAGGACATCTTGTGTCTGTGCTCAGTGGCGCTG AAGCTTCCTTCCTGTCCTCCATGATCAAAAGCAGTGGTAACAGTGGCCAATATGTATGGATTGGGCTCCA TGACCCGACACTGGGCTATGAACCCAACAGAGGTGGATGGGAGTGGAGCAATGCTGATGTGATGAATTAC ATCAACTGGGAGACGAATCCTTCCTCTTCCTCAGGCAATCACTGTGGTACCCTGTCAAGAGCCTCAGGAT TTCTGAAGTGGAGAGAGAATTATTGTAACTTAGAGTTACCCTATGTCTGCAAATTCAAGGCCTAGAGTAC AGAATTGACATCATGGGTTGATATATACCTAGCCACAAGCAAGATCCCAAATGTGAAGACAGATGAAAAA GGGAACATTCTCCCCACAATCGAAATCTGACCTCCTGATTTTCTCCTTCTCTGGCCCTTCCCTCCTCTCA TTTGAGGAACTCTGTGTGCACTATGGCCTTAATTCTCAAAGCATAATATTAAAGTATATAACTCATGCTC TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_011260 |
| Insert Size | 525 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC061139, AAH61139 |
| RefSeq Size | 801 bp |
| RefSeq ORF | 525 bp |
| Locus ID | 19695 |
| UniProt ID | O09049 |
| Gene Summary | This gene encodes a C-type lectin that demonstrates bactericidal activity. This gene is predominantly expressed in the distal small intestine where the encoded protein undergoes proteolytic processing by trypsin. Mice lacking the encoded protein exhibit altered mucus distribution, increased bacterial contact with the epithelium, and elevated inflammatory markers in the ileum, and low-grade inflammation. [provided by RefSeq, Jun 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201504 | Reg3g (tGFP-tagged) - Mouse regenerating islet-derived 3 gamma (Reg3g) |
CNY 4000.00 |
|
| MR201504 | Reg3g (Myc-DDK-tagged) - Mouse regenerating islet-derived 3 gamma (Reg3g) |
CNY 2400.00 |
|
| MR201504L3 | Lenti ORF clone of Reg3g (Myc-DDK-tagged) - Mouse regenerating islet-derived 3 gamma (Reg3g) |
CNY 4750.00 |
|
| MR201504L4 | Lenti ORF clone of Reg3g (mGFP-tagged) - Mouse regenerating islet-derived 3 gamma (Reg3g) |
CNY 4800.00 |
