Copz2 (NM_019877) Mouse Untagged Clone

CAT#: MC205815

Copz2 (untagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2), (10ug)



  "NM_019877" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110012D12Rik; zeta2-COP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC025122
CGAGCGGAATGCAGCGGCCGGAGGCCTGGCCACGTCCGCACCCGGGGGAGGGGGCCTCAGCCGCCCAAGC CGGGGGCGCAGCGCCGCCCACCCGAGCCACGGAACAGCGGGAACCTTCTCTCTACACCATCAAGGCTGTC TTCATCTTAGATAATGACGGGCGAAGGCTGCTGGCCAAGTATTATGACGACACATTTCCCTCCGTGAAGG AGCAGATGGTTTTCGAGAAAAATGTCTTCAACAAGACCAGCCGCACCGAAAGTGAAATTGCATTTTTGGG GGGCATGACTATCGTCTACAAGAGCAGCATTGACATCTTCCTGTATGTGGTGGGATCTTCCTCCGAGAAT GAGCTGATGCTCATGTCTGTGCTTGCCTGCCTGTTTGACTCTCTGAGCCACATCTTAAGGAAGAACGTGG AGAAACGCTGGTTGCTGGAGAACATGGACGGAGCCTTCTTGGTGCTGGATGAAACTGTCGATGGAGGTGT GATTCTGGAGAGCGACCCCCAGCAAGTGATCCAGAAAGTGAATTTTAGGACTGATGACAGTGGCCTAACA GAACAGAGTGTGGCCCAGGTTCTTCAGTCAGCCAAGGAACAGATTAAATGGTCGCTATTGAAATGAAGAC CTTGGAATCAAGGCTCCTTCCCCAGAGAACTTTTGCCAGTCCCCGCGTAAGCCCCAAGATCTCAAGACGC AAGAGAGACCACTCTGCCTTCTCAGGCCTCTCTCAGAACTGATCCCTGAGGTCTCCTGCCAGGGATTCTG AGACGCAAAAGCTTGACCCCAGCTCCCTCACCCCTACTCAGCATCCTAACCTGGCCTTGGGGCCATGGGA ACCAGCAAAGTTGCCTCCCCTCGGACCTCTGACATCCTCAGTCCTAGGCCTTAATAAACTTACATTTTTC CCCCCCAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019877
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC025122, AAH25122
RefSeq Size 936 bp
RefSeq ORF 618 bp
Locus ID 56358
UniProt ID Q9JHH9
Gene Summary The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. The zeta subunit may be involved in regulating the coat assembly and, hence, the rate of biosynthetic protein transport due to its association-dissociation properties with the coatomer complex (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...