Bcl2l1 (NM_009743) Mouse Untagged Clone
CAT#: MC207993
Bcl2l1 (untagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Bcl; Bcl(X; Bcl(X)L; bcl-; bcl-x; Bcl-XL; bcl2-L-1; Bcl2l; BclX |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207993 representing NM_009743
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCT GGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGAC CCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGC CACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAG GCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGG GACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATC GTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGA GTCGGATTGCAAGTTGGATGGCCACCTATCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGG CTGGGACACTTTTGTGGATCTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAAGGCCAGGAGCGCTTC AACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGTGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAGT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009743 |
| Insert Size | 702 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC089016, AAH89016 |
| RefSeq Size | 2421 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 12048 |
| UniProt ID | Q64373 |
| Gene Summary | This gene encodes a member of the Bcl-2 family of apoptosis regulators. The encoded protein is localized to the inner and outer mitochondrial membranes and regulates the programmed cell death pathway during development and tissue homeostasis. This protein binds to voltage-dependent anion channels in the outer mitochondrial membrane to facilitate the uptake of calcium ions. Mice embryos lacking this gene survived for two weeks and exhibited cell death of immature hematopoietic cells and neurons. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 5. Variants 1, 2, 3, and 5 all encode the same isoform (a, also known as Bcl-xL; PMID 7607090). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202824 | Bcl2l1 (tGFP-tagged) - Mouse Bcl2-like 1 (Bcl2l1) |
CNY 5200.00 |
|
| MR202824 | Bcl2l1 (Myc-DDK-tagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein |
CNY 3600.00 |
|
| MR202824L1 | Lenti ORF clone of Bcl2l1 (Myc-DDK-tagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein |
CNY 6000.00 |
|
| MR202824L2 | Lenti ORF clone of Bcl2l1 (mGFP-tagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein |
CNY 6000.00 |
|
| MR202824L3 | Lenti ORF clone of Bcl2l1 (Myc-DDK-tagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein |
CNY 4180.00 |
|
| MR202824L4 | Lenti ORF clone of Bcl2l1 (mGFP-tagged) - Mouse BCL2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein |
CNY 6000.00 |

