Yy1 (NM_009537) Mouse Untagged Clone
CAT#: MC208051
Yy1 (untagged) - Mouse YY1 transcription factor (Yy1), (10ug)
CNY 3990.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW488674; NF-E1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208051 representing NM_009537
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTCGGGCGACACCCTCTACATCGCCACGGACGGCTCGGAGATGCCGGCCGAGATCGTGGAGCTGC ATGAGATCGAGGTGGAGACCATCCCGGTGGAGACCATCGAGACCACGGTGGTGGGCGAGGAGGAGGAGGA GGACGACGACGACGAGGACGGCGGCGGCGGCGACCACGGCGGCGGCGGGGGCGGCCACGGGCACGCCGGC CACCACCATCACCACCACCACCACCACCACCACCACCCGCCCATGATCGCGCTGCAGCCGCTGGTGACGG ACGACCCGACCCAAGTGCACCACCACCAGGAGGTGATCCTGGTGCAGACGCGCGAGGAGGTGGTCGGCGG GGACGACTCGGACGGGCTGCGCGCCGAGGACGGCTTCGAGGACCAGATCCTCATCCCGGTGCCCGCGCCG GCCGGCGGCGACGACGACTACATAGAGCAGACGCTGGTCACCGTGGCGGCGGCCGGCAAGAGCGGCGGCG GGGCCTCGTCGGGCGGCGGTCGCGTGAAGAAGGGCGGCGGCAAGAAGAGCGGCAAGAAGAGTTACCTGGG CGGCGGGGCCGGCGCGGCGGGCGGCGGCGGCGCCGACCCGGGGAATAAGAAGTGGGAGCAGAAGCAGGTG CAGATCAAGACCCTGGAGGGCGAGTTCTCGGTCACCATGTGGTCCTCGGATGAAAAAAAAGATATTGACC ATGAAACAGTGGTTGAAGAGCAGATCATTGGAGAGAACTCACCTCCTGATTATTCTGAATATATGACAGG CAAGAAACTCCCTCCTGGAGGGATACCTGGCATTGACCTCTCAGACCCTAAGCAACTGGCAGAATTTGCC AGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCA CAAAGATGTTCAGGGATAACTCTGCTATGAGAAAGCATCTGCACACCCACGGTCCCAGAGTCCACGTCTG TGCAGAGTGTGGCAAAGCGTTCGTTGAGAGCTCAAAGCTAAAACGACACCAGCTGGTTCATACTGGAGAA AAGCCCTTTCAGTGCACATTCGAAGGCTGCGGGAAGCGCTTTTCACTGGACTTCAATTTGCGCACACATG TGCGAATCCATACCGGAGACAGGCCCTATGTGTGCCCCTTCGACGGTTGTAATAAGAAGTTTGCTCAGTC AACTAACCTGAAATCTCACATCTTAACACACGCTAAAGCCAAAAACAACCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009537 |
| Insert Size | 1245 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009537.3, NP_033563.2 |
| RefSeq Size | 2324 bp |
| RefSeq ORF | 1245 bp |
| Locus ID | 22632 |
| UniProt ID | Q00899 |
| Gene Summary | Multifunctional transcription factor that exhibits positive and negative control on a large number of cellular and viral genes by binding to sites overlapping the transcription start site. Binds to the consensus sequence 5'-CCGCCATNTT-3'; some genes have been shown to contain a longer binding motif allowing enhanced binding; the initial CG dinucleotide can be methylated greatly reducing the binding affinity. The effect on transcription regulation is depending upon the context in which it binds and diverse mechanisms of action include direct activation or repression, indirect activation or repression via cofactor recruitment, or activation or repression by disruption of binding sites or conformational DNA changes. Its activity is regulated by transcription factors and cytoplasmic proteins that have been shown to abrogate or completely inhibit YY1-mediated activation or repression. Binds to the upstream conserved region (UCR) (5'-CGCCATTTT-3') of Moloney murine leukemia virus (MuLV). Acts synergistically with the SMAD1 and SMAD4 in bone morphogenetic protein (BMP)-mediated cardiac-specific gene expression (PubMed:15329343). Binds to SMAD binding elements (SBEs) (5'-GTCT/AGAC-3') within BMP response element (BMPRE) of cardiac activating regions (PubMed:15329343). Proposed to recruit the PRC2/EED-EZH2 complex to target genes that are transcriptional repressed. Involved in DNA repair. In vitro, binds to DNA recombination intermediate structures (Holliday junctions). Involved in spermatogenesis and may play a role in meiotic DNA double-strand break repair. Plays a role in regulating enhancer activation (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
MicroRNA-29a promotes smooth muscle cell differentiation from stem cells by targeting YY1
,Jin, M;Wu, Y;Wang, Y;Yu, D;Yang, M;Yang, F;Feng, C;Chen, T;,
Stem Cell Res
,PubMed ID 27591939
[YY1]
|
|
Directed targeting of chromatin to the nuclear lamina is mediated by chromatin state and A-type lamins
,Harr, JC;Luperchio, TR;Wong, X;Cohen, E;Wheelan, SJ;Reddy, KL;,
J. Cell Biol.
,PubMed ID 25559185
[YY1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG206531 | Yy1 (tGFP-tagged) - Mouse YY1 transcription factor (Yy1) |
CNY 3140.00 |
|
| MR206531 | Yy1 (Myc-DDK-tagged) - Mouse YY1 transcription factor (Yy1) |
CNY 3656.00 |
|
| MR206531L3 | Lenti ORF clone of Yy1 (Myc-DDK-tagged) - Mouse YY1 transcription factor (Yy1) |
CNY 4750.00 |
|
| MR206531L4 | Lenti ORF clone of Yy1 (mGFP-tagged) - Mouse YY1 transcription factor (Yy1) |
CNY 6056.00 |
