Bglap (NM_001037939) Mouse Untagged Clone
CAT#: MC208187
Bglap (untagged) - Mouse bone gamma carboxyglutamate protein (Bglap), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Bglap1; mOC-A; OC; OG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208187 representing NM_001037939
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGACCATCTTTCTGCTCACTCTGCTGACCCTGGCTGCGCTCTGTCTCTCTGACCTCACAGATGCCA AGCCCAGCGGCCCTGAGTCTGACAAAGCCTTCATGTCCAAGCAGGAGGGCAATAAGGTAGTGAACAGACT CCGGCGCTACCTTGGGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037939 |
Insert Size | 159 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037939.2, NP_001033028.1 |
RefSeq Size | 702 bp |
RefSeq ORF | 159 bp |
Locus ID | 12096 |
Gene Summary | This gene encodes one of the most abundant non-collagenous proteins in bone tissue that is localized to the mineralized matrix of bone. The encoded preproprotein undergoes proteolytic processing and post-translational gamma carboxylation to generate a mature, calcium-binding protein. Mice lacking the encoded protein develop abnormalities of bone remodelling. This gene is located adjacent to two other osteocalcin-related genes on chromosome 3. [provided by RefSeq, Oct 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226350 | Bglap (tGFP-tagged) - Mouse bone gamma carboxyglutamate protein (Bglap) transcript variant 2, (10ug) |
CNY 2090.00 |
|
MR226350 | Bglap (Myc-DDK-tagged) - Mouse bone gamma carboxyglutamate protein (Bglap), transcript variant 2 |
CNY 1900.00 |
|
MR226350L3 | Lenti ORF clone of Bglap (Myc-DDK-tagged) - Mouse bone gamma carboxyglutamate protein (Bglap), transcript variant 2 |
CNY 3800.00 |
|
MR226350L4 | Lenti ORF clone of Bglap (mGFP-tagged) - Mouse bone gamma carboxyglutamate protein (Bglap), transcript variant 2 |
CNY 3800.00 |