Cd247 (NM_001113393) Mouse Untagged Clone

CAT#: MC208248

Cd247 (untagged) - Mouse CD247 antigen (Cd247), transcript variant theta, (10ug)



  "NM_001113393" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CD247 Antibody - middlel region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4930549J05Rik; A430104F18Rik; AW552088; Cd3; Cd3-eta; Cd3-zeta; Cd3h; Cd3z; Cd3zeta; T3z; Tcrk
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208248 representing NM_001113393
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTGGAAAGTGTCTGTTCTCGCCTGCATCCTCCACGTGCGGTTCCCAGGAGCAGAGGCACAGAGCT
TTGGTCTGCTGGATCCCAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGGAGTCATCATCAC
AGCCCTGTACCTGAGAGCAAAATTCAGCAGGAGTGCAGAGACTGCTGCCAACCTGCAGGACCCCAACCAG
CTCTACAATGAGCTCAATCTAGGGCGAAGAGAGGAATATGACGTCTTGGAGAAGAAGCGGGCTCGGGATC
CAGAGATGGGAGGCAAACAGAGGAGGAGGAACCCCCAGGAAGGCGTATACAATGCACTGCAGAAAGACAA
GATGGCAGAAGCCTACAGTGAGATCGGCACAAAAGGCGAGAGGCGGAGAGGCAAGGGGCACGATGGCCTT
TACCAGGACAGCCACTTCCAAGCAGTGCAGTTCGGGAACAGAAGAGAGAGAGAAGGTTCAGAACTCACAA
GGACCCTTGGGTTAAGAGCCCGCCCCAAAGCCTGCCGACATAAGAAGCCTCTTAGCCTCCCAGCAGCCGT
ATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001113393
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001113393.2, NP_001106864.2
RefSeq Size 2804 bp
RefSeq ORF 567 bp
Locus ID 12503
Gene Summary Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. CD3Z ITAMs phosphorylation creates multiple docking sites for the protein kinase ZAP70 leading to ZAP70 phosphorylation and its conversion into a catalytically active enzyme. Plays an important role in intrathymic T-cell differentiation. Additionally, participates in the activity-dependent synapse formation of retinal ganglion cells (RGCs) in both the retina and dorsal lateral geniculate nucleus (dLGN).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (theta) uses an alternate in-frame splice site in the central coding region, and has alternate exon structure in the 3' coding region and 3' UTR, compared to variant zeta. The resulting isoform (theta) has a distinct C-terminus and is longer than isoform zeta. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...