Cflar (NM_009805) Mouse Untagged Clone
CAT#: MC208280
Cflar (untagged) - Mouse CASP8 and FADD-like apoptosis regulator (Cflar), transcript variant 2, (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310024N18Rik; A430105C05Rik; c-Flip; Cash; Casper; CLARP; ENSMUSG00000072980; FLAME; FLAME-1; Flip |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208280 representing NM_009805
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCAGAGCCCTGTGTCTGCCGAGGTCATTCACCAGGTGGAAGAGTGTCTTGATGAAGACGAGAAGG AGATGATGCTCTTCCTGTGTAGAGATGTGACTGAGAACCTGGCTGCACCTAACGTCAGGGACCTCCTGGA TAGCTTAAGTGAGAGAGGCCAGCTCTCTTTTGCTACCTTGGCTGAATTGCTCTACAGAGTGAGGCGGTTT GACCTTCTCAAGAGGATCTTGAAGACAGACAAAGCAACCGTGGAGGACCACCTGCGCAGAAACCCTCACC TGGTTTCTGATTATAGGGTCCTGCTGATGGAGATTGGTGAGAGCTTAGATCAGAACGATGTATCCTCCTT AGTTTTCCTTACAAGGGATTACACAGGCAGAGGCAAGATAGCCAAGGACAAGAGTTTCTTGGATCTGGTG ATTGAATTGGAGAAACTGAATCTAATTGCTTCAGACCAATTGAATTTGTTAGAAAAATGCCTGAAGAACA TCCACAGAATAGACTTGAACACAAAGATCCAGAAGTACACCCAGTCCAGCCAAGGAGCAAGATCAAATAT GAATACTCTCCAGGCTTCGCTCCCAAAATTGAGTATCAAGTATAACTCAAGGGTGAGTCTGGAGCCAGTG TATGGAGTACCAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009805 |
Insert Size | 648 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009805.4, NP_033935.2 |
RefSeq Size | 2036 bp |
RefSeq ORF | 648 bp |
Locus ID | 12633 |
Gene Summary | Apoptosis regulator protein which may function as a crucial link between cell survival and cell death pathways in mammalian cells. Acts as an inhibitor of TNFRSF6 mediated apoptosis. A proteolytic fragment (p43) is likely retained in the death-inducing signaling complex (DISC) thereby blocking further recruitment and processing of caspase-8 at the complex. Full length and shorter isoforms have been shown either to induce apoptosis or to reduce TNFRSF-triggered apoptosis. Lacks enzymatic (caspase) activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222341 | Cflar (tGFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (Cflar) transcript variant 2, (10ug) |
CNY 2380.00 |
|
MR222341 | Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (Cflar), transcript variant 2 |
CNY 2190.00 |
|
MR222341L3 | Lenti ORF clone of Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (Cflar), transcript variant 2 |
CNY 4090.00 |
|
MR222341L4 | Lenti ORF clone of Cflar (mGFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (Cflar), transcript variant 2 |
CNY 4090.00 |