Mecom (NM_021442) Mouse Untagged Clone
CAT#: MC208456
Mecom (untagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | D630039M04Rik; Evi-1; Evi1; Jbo; Mds; Mds1; Mds1-Evi1; Prdm3; Znfpr1b1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208456 representing NM_021442
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAGTAATGAGTGTGCCTATGGCAACTATCCTGAAA TACCTTTGGAAGAAATGCCAGATGCTGATGCAGATGGGATAACCAGTGTTCCCTCCCTCCACATTCAAGA GCCATGCTCTCCTGCGACGTCCAGTGAGTCATTTACTCCTAAGGAGGGCTCGCCATACAAAGCTCCCATC TACATCCCTGATGACATCCCTATTCCTGATGAGTTTGAGCTTCGAGAGTCAACTATGCCTGGAGCAGGAC TTGGAATATGGACCAAAAGGAAGATTGAAATAGGCGAAAAGTTTGGGCCATACATGGGAGAGCAGAGATC AGACCTGAAAGATTCCAGCTATGGATGGGAGAACAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021442 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021442.2, NP_067417.1 |
RefSeq Size | 1075 bp |
RefSeq ORF | 390 bp |
Locus ID | 14013 |
UniProt ID | P14404 |
Gene Summary | Isoform 1: Functions as a transcriptional regulator binding to DNA sequences in the promoter region of target genes and regulating positively or negatively their expression. Oncogene which plays a role in development, cell proliferation and differentiation. May also play a role in apoptosis through regulation of the JNK and TGF-beta signaling. Involved in hematopoiesis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222587 | Mecom (tGFP-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom) transcript variant 2, (10ug) |
CNY 2850.00 |
|
MR222587 | Mecom (Myc-DDK-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2 |
CNY 1800.00 |
|
MR222587L1 | Lenti ORF clone of Mecom (Myc-DDK-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2 |
CNY 4750.00 |
|
MR222587L2 | Lenti ORF clone of Mecom (mGFP-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2 |
CNY 4200.00 |
|
MR222587L3 | Lenti ORF clone of Mecom (Myc-DDK-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2 |
CNY 4750.00 |
|
MR222587L4 | Lenti ORF clone of Mecom (mGFP-tagged) - Mouse MDS1 and EVI1 complex locus (Mecom), transcript variant 2 |
CNY 4750.00 |