Gcsam (NM_008099) Mouse Untagged Clone

CAT#: MC208530

Gcsam (untagged) - Mouse germinal center expressed transcript 2 (Gcet2), transcript variant 2, (10ug)



  "NM_008099" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gcet; Gcet2; M17; M17-L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208530 representing NM_008099
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAACTGTTTGCAGAGGACAACCAGATACTTCAGGGGCTGGAGTTGTTGTCACAGCGTTGAAGGAT
GCTCCTGCCTTCCTTGGAAAAACATACGCACATTTAAAGCCAGACAAGAGTCTCCAAAGCAAAATGAAGG
GATGACTTCAGCTCCCGTTCAGGACAATGCTAATGAGACCTACACAGAAGAGTTGTGCTACATCCTTGTT
GATCACGAAGCTGTCAGGGGAAGGCCATCAGTGAACCCTGCTGAGGGGTTCTACGAGAACATCTCTAACA
AGGCTGAGAGACACAAAGAGTCTTCAAGAGGAACAGAGACTGAGTATTCGGTTCTCCGTTTCCCTTCTCC
CCCTCAGCCCCTACCTTCCACAGATGATGAATATGAACTTCTTATGCCCAGCAGATTCTCCTCACATGCC
TTTCAACAGCCACGGCCGCTTACAACCCCCTACGAGACACACTTTTCTTATCCACAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008099
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008099.4, NP_032125.3
RefSeq Size 3298 bp
RefSeq ORF 480 bp
Locus ID 14525
UniProt ID Q6RFH4
Gene Summary Involved in the negative regulation of lymphocyte motility. It mediates the migration-inhibitory effects of IL6. Serves as a positive regulator of the RhoA signaling pathway. Enhancement of RhoA activation results in inhibition of lymphocyte and lymphoma cell motility by activation of its downstream effector ROCK. Is a regulator of B-cell receptor signaling, that acts through SYK kinase activation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This difference results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...