Gcsam (NM_008099) Mouse Untagged Clone
CAT#: MC208530
Gcsam (untagged) - Mouse germinal center expressed transcript 2 (Gcet2), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Gcet; Gcet2; M17; M17-L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208530 representing NM_008099
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAACTGTTTGCAGAGGACAACCAGATACTTCAGGGGCTGGAGTTGTTGTCACAGCGTTGAAGGAT GCTCCTGCCTTCCTTGGAAAAACATACGCACATTTAAAGCCAGACAAGAGTCTCCAAAGCAAAATGAAGG GATGACTTCAGCTCCCGTTCAGGACAATGCTAATGAGACCTACACAGAAGAGTTGTGCTACATCCTTGTT GATCACGAAGCTGTCAGGGGAAGGCCATCAGTGAACCCTGCTGAGGGGTTCTACGAGAACATCTCTAACA AGGCTGAGAGACACAAAGAGTCTTCAAGAGGAACAGAGACTGAGTATTCGGTTCTCCGTTTCCCTTCTCC CCCTCAGCCCCTACCTTCCACAGATGATGAATATGAACTTCTTATGCCCAGCAGATTCTCCTCACATGCC TTTCAACAGCCACGGCCGCTTACAACCCCCTACGAGACACACTTTTCTTATCCACAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008099 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008099.4, NP_032125.3 |
RefSeq Size | 3298 bp |
RefSeq ORF | 480 bp |
Locus ID | 14525 |
UniProt ID | Q6RFH4 |
Gene Summary | Involved in the negative regulation of lymphocyte motility. It mediates the migration-inhibitory effects of IL6. Serves as a positive regulator of the RhoA signaling pathway. Enhancement of RhoA activation results in inhibition of lymphocyte and lymphoma cell motility by activation of its downstream effector ROCK. Is a regulator of B-cell receptor signaling, that acts through SYK kinase activation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This difference results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216433 | Gcsam (tGFP-tagged) - Mouse germinal center expressed transcript 2 (Gcet2) transcript variant 2, (10ug) |
CNY 2090.00 |
|
MR216433 | Gcsam (Myc-DDK-tagged) - Mouse germinal center expressed transcript 2 (Gcet2), transcript variant 2 |
CNY 1900.00 |
|
MR216433L3 | Lenti ORF clone of Gcsam (Myc-DDK-tagged) - Mouse germinal center expressed transcript 2 (Gcet2), transcript variant 2 |
CNY 3800.00 |
|
MR216433L4 | Lenti ORF clone of Gcsam (mGFP-tagged) - Mouse germinal center expressed transcript 2 (Gcet2), transcript variant 2 |
CNY 3800.00 |