Igf1 (NM_010512) Mouse Untagged Clone

CAT#: MC208756

Igf1 (untagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 1, (10ug)



  "NM_010512" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C730016P09Rik; Igf; Igf-; Igf-1; Igf-I
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NM_010512.4
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAAAATCAGCAGCCTTCCAACTCAATTATTTAAGATCTGCCTCTGTGACTTCTTGAAGATAAAGA
TACACATCATGTCGTCTTCACACCTCTTCTACCTGGCGCTCTGCTTGCTCACCTTCACCAGCTCCACCAC
AGCTGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGATGCTCTTCAGTTCGTGTGTGGACCGAGGGGC
TTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCACCTCAGACAGGCATTGTGGATG
AGTGTTGCTTCCGGAGCTGTGATCTGAGGAGACTGGAGATGTACTGTGCCCCACTGAAGCCTACAAAAGC
AGCCCGCTCTATCCGTGCCCAGCGCCACACTGACATGCCCAAGACTCAGAAGTCCCCGTCCCTATCGACA
AACAAGAAAACGAAGCTGCAAAGGAGAAGGAAAGGAAGTACATTTGAAGAACACAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010512
Insert Size 480 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_010512.4, NP_034642.2
RefSeq Size 7121 bp
RefSeq ORF 480 bp
Locus ID 16000
UniProt ID P05017
Gene Summary This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). This isoform (1) is also known as IB. This isoform (1) may undergo proteolytic processing similar to isoform 4. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...