Tdg (NM_011561) Mouse Untagged Clone

CAT#: MC209506

Tdg (untagged) - Mouse thymine DNA glycosylase (Tdg), transcript variant 1, (10ug)



  "NM_011561" in other vectors (3)

CNY 3990.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms E130317C12Rik; JZA-3; Jza1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209506 representing NM_011561
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGCAGAAGTTCCTAACATGGCAGTCACGACTGGACAGCAGGTGCCAGCAGTAGCTCCTAACATGG
CAACCGTGACAGAACAGCAGGTGCCCGAAGACGCTCCTGTCCAGGAACCTGCACCAGAAGCTCCAAAGAG
AAGGAAAAGGAAACCCAGAGCAGCAGAGCCCCAGGAACCAGTGGAGCCCAAAAAACCTGCTACGTCGAAG
AAATCCGGCAAGTCTACAAAATCAAAGGAAAAGCAGGAGAAAATCACAGACGCGTTTAAAGTGAAAAGGA
AAGTGGACCGCTTCAACGGCGTCTCTGAAGCTGAGCTTCTGACCAAGACTCTTCCTGACATTTTGACCTT
CAATCTGGATATTGTGATCATTGGCATTAACCCGGGATTAATGGCTGCTTACAAAGGACATCACTACCCT
GGGCCTGGAAATCACTTCTGGAAGTGTCTGTTCATGTCGGGGCTGAGTGAGGTGCAGCTGAATCACATGG
ATGACCACACCTTACCCGGCAAGTACGGCATCGGATTCACCAACATGGTGGAACGGACGACGCCGGGCAG
CAAGGATCTGTCTAGTAAAGAGTTCCGGGAAGGAGGGCGCATCCTGGTGCAGAAACTGCAGAAATATCAG
CCACGAATAGCGGTGTTTAATGGAAAATGTATTTATGAAATTTTCAGTAAAGAAGTTTTTGGAGTAAAGG
TTAAGAACTTGGAATTTGGGCTTCAACCCCACAAGATCCCAGACACAGAAACTCTGTGCTACGTCATGCC
GTCGTCCAGCGCCAGATGTGCTCAGTTTCCCCGGGCCCAGGACAAAGTTCATTACTACATTAAGCTGAAG
GACTTGAGAGACCAACTGAAAGGCATTGAACGCAACGCGGACGTTCAGGAAGTGCAGTATACATTTGACC
TGCAGCTTGCGCAAGAGGACGCAAAGAAGATGGCTGTTAAGGAAGAAAAGTATGATCCAGGCTATGAGGC
AGCTTACGGCGGTGCCTATGGGGAAAACCCATGTAATGGGGAACCTTGTGGCATTGCTTCAAATGGGCTA
ACAGCTCACAGTGCGGAGCCGAGAGGAGAAGCGGCCCCCAGCGATGTTCCGAATGGGCAGTGGATGGCAC
AGTCGTTTGCAGAGCAGATCCCTTCTTTTAATAATTGTGGGACCCGAGAGCAGGAAGAAGAGAGCCACGC
TTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_011561
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011561.2, NP_035691.2
RefSeq Size 3119 bp
RefSeq ORF 1194 bp
Locus ID 21665
UniProt ID P56581
Gene Summary DNA glycosylase that plays a key role in active DNA demethylation: specifically recognizes and binds 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) in the context of CpG sites and mediates their excision through base-excision repair (BER) to install an unmethylated cytosine (PubMed:21817016). Cannot remove 5-hydroxymethylcytosine (5hmC). According to an alternative model, involved in DNA demethylation by mediating DNA glycolase activity toward 5-hydroxymethyluracil (5hmU) produced by deamination of 5hmC (PubMed:21722948). Also involved in DNA repair by acting as a thymine-DNA glycosylase that mediates correction of G/T mispairs to G/C pairs: in the DNA of higher eukaryotes, hydrolytic deamination of 5-methylcytosine to thymine leads to the formation of G/T mismatches. Its role in the repair of canonical base damage is however minor compared to its role in DNA demethylation. It is capable of hydrolyzing the carbon-nitrogen bond between the sugar-phosphate backbone of the DNA and a mispaired thymine. In addition to the G/T, it can remove thymine also from C/T and T/T mispairs in the order G/T >> C/T > T/T. It has no detectable activity on apyrimidinic sites and does not catalyze the removal of thymine from A/T pairs or from single-stranded DNA. It can also remove uracil and 5-bromouracil from mispairs with guanine.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) lacks an alternate in-frame segment in the 5' coding region and uses a downstream start codon, compared to variant 2. Isoform 1 has a shorter N-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...