Trp53inp1 (NM_021897) Mouse Untagged Clone
CAT#: MC210213
Trp53inp1 (untagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2700057G22Rik; SIP; SIP18; SIP27; Stinp; Teap |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210213 representing NM_021897
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTCAGAGACTGAATAAAATGTTTGTAGGCGAAGTCACTACTTCTTCCAGCCAAGAACCAGAATTCA GTGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACCTGCCCTGGTTTCTCAGCAGAGGA AGAGGAAGAAGATGAAGACATTGGTGAAGAGTCCTCAGCAGAGCACACTTCTGTCTTCTCCTGTTTACCT GCATCTTTGGAATGCTTGACTGACACCAGTGATTCCTGCTTCCTTCAGTTTGAGTCCTGTCCAATGGAGG AGAGCTGGTTCATCACTCCTCCCCCATGTTTTACAGCAGGTGGATTAACCACTATCAAGGTGGAAACAAG TCCTATGGAAAACCTTCTCATTGAACATCCCAGCATGTCTGTCTATGCTGTGCACAACTCCTGTCCTGGT CTCAGTGAGGCGAGTTGTGGAAATGATGAATATAACTCAAGTGGTCCCAGAATGGAAGCCCAGAGTGAAA TGGGGAAGCACATTCACTGCTGTGTGGCAGCACTTGCTGCTCAGGCAACATTTTTGGAACAACCCAAGAG TTTTCGCCCTTCCCAGTGGATAAAAGGACACAGTGAAAGACAGTCTTTGAACAGAAATGGTCTCCGTCGC CAGAACCTTACCAGGGATTGCCACACTCGACAAATGAAGCACAGTGGCTGGGTGGTTCACCAGCCCTGCC CACGCCAGTACAATTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021897 |
Insert Size | 720 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021897.3, NP_068697.1 |
RefSeq Size | 5392 bp |
RefSeq ORF | 720 bp |
Locus ID | 60599 |
UniProt ID | Q9QXE4 |
Gene Summary | Antiproliferative and proapoptotic protein involved in cell stress response which acts as a dual regulator of transcription and autophagy. Acts as a positive regulator of autophagy. In response to cellular stress or activation of autophagy, relocates to autophagosomes where it interacts with autophagosome-associated proteins GABARAP, GABARAPL1/L2, MAP1LC3A/B/C and regulates autophagy. Acts as an antioxidant and plays a major role in p53/TP53-driven oxidative stress response. Possesses both a p53/TP53-independent intracellular reactive oxygen species (ROS) regulatory function and a p53/TP53-dependent transcription regulatory function. Positively regulates p53/TP53 and p73/TP73 and stimulates their capacity to induce apoptosis and regulate cell cycle. In response to double-strand DNA breaks, promotes p53/TP53 phosphorylation on 'Ser-46' and subsequent apoptosis. Acts as a tumor suppressor by inducing cell death by an autophagy and caspase-dependent mechanism. Can reduce cell migration by regulating the expression of SPARC.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1; also known as SIP27). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223924 | Trp53inp1 (tGFP-tagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), (10ug) |
CNY 5200.00 |
|
MR223924 | Trp53inp1 (Myc-DDK-tagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 1 |
CNY 3600.00 |
|
MR223924L3 | Lenti ORF clone of Trp53inp1 (Myc-DDK-tagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 1 |
CNY 5890.00 |
|
MR223924L4 | Lenti ORF clone of Trp53inp1 (mGFP-tagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 1 |
CNY 5890.00 |
其它Trp53inp1产品