Cldn12 (NM_001193660) Mouse Untagged Clone
CAT#: MC210234
Cldn12 (untagged) - Mouse claudin 12 (Cldn12), transcript variant 3, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210234 representing NM_001193660
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTGCCGAGATGTCCACGCAGCCACCGTCCTGTCCTTCCTGTGTGGTATTGCCTCTGTCGCAGGCC TCTTTGCGGGGACTCTGCTTCCTAACTGGAGGAAACTGCGGCTGATCACATTCAACAGAAACGAGAAGAA CCTGACGATTTACACGGGCCTGTGGGTGAAGTGTGCCCGGTATGATGGAAGCAGTGACTGCCTGATGTAC GACCGTACGTGGTACCTGTCGGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTGCCTCTCAGCA TCGTGATCGCAATGGGTGCCTTGCTACTCTGCCTGATTGGAATGTGTAACACGGCCTTCAATTCTTCCGT GCCTAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGCTGCCACCTGGTGGCCGGACTCCTGTTT TTTCTGGCAGGTACCGTGAGCCTCTCTCCGTCCATCTGGGCCATCTTTTATAACAGCCATCTCAACAGGA AGTTTGAGCCGGTCTTTACCTTTGACTATGCAGTATTTGTCACTATTGCTAGCTCAGGGGGTCTGTTTAT GACTGCTCTCCTGCTGTTCGTTTGGTATTGTGCATGCAAGTCTTTGTCCTCTCCTTTCTGGCAACCGCTG TACTCTCACGCTCCCGGGATGCACACTTACTCACAGCCCTATTCATCACGGTCCCGCCTCTCTGCCATTG AAATCGACATTCCAGTAGTCTCACACAGCACTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001193660 |
Insert Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001193660.1, NP_001180589.1 |
RefSeq Size | 3752 bp |
RefSeq ORF | 735 bp |
Locus ID | 64945 |
UniProt ID | Q9ET43 |
Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene, along with several other family members, is expressed in the inner ear. The protein encoded by this gene and another family member, claudin 2, are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225328 | Cldn12 (tGFP-tagged) - Mouse claudin 12 (Cldn12) transcript variant 3, (10ug) |
CNY 2850.00 |
|
MR225328 | Cldn12 (Myc-DDK-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 |
CNY 2400.00 |
|
MR225328L3 | Lenti ORF clone of Cldn12 (Myc-DDK-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 |
CNY 4750.00 |
|
MR225328L4 | Lenti ORF clone of Cldn12 (mGFP-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 |
CNY 4750.00 |