Atp6v1g1 (NM_024173) Mouse Untagged Clone
CAT＃: MC210320
Atp6v1g1 (untagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1810024D14Rik; AA960677; Atp6g1; ATP6J; VAG1; Vma10 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210320 representing NM_024173
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGAGTCAGTCGCAGGGCATCCAGCAGCTACTGCAGGCCGAGAAGCGGGCCGCCGAGAAGGTGTCCG AGGCCCGCAAGCGAAAGAACCGGAGGCTGAAGCAGGCCAAAGAAGAAGCCCAGGCTGAAATTGAACAGTA CCGCCTGCAGAGGGAGAAGGAGTTCAAGGCCAAGGAAGCTGCGGCATTGGGCTCCCATGGCAGCTGCAGC AGTGAGGTGGAAAAGGAGACCCGGGAGAAGATGACCGTCCTCCAGAACTACTTCGAGCAGAACAGGGATG AAGTCCTGGATAACCTCTTGGCCTTTGTGTGTGACATCCGGCCGGAAATCCATGAAAACTACCGCATAAA CGGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_024173 |
| Insert Size | 357 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_024173.2, NP_077135.1 |
| RefSeq Size | 1109 bp |
| RefSeq ORF | 357 bp |
| Locus ID | 66290 |
| UniProt ID | Q9CR51 |
| Gene Summary | Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase). V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells. In aerobic conditions, involved in intracellular iron homeostasis, thus triggering the activity of Fe(2+) prolyl hydroxylase (PHD) enzymes, and leading to HIF1A hydroxylation and subsequent proteasomal degradation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200546 | Atp6v1g1 (tGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1) |
CNY 2850.00 |
|
| MR200546 | Atp6v1g1 (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1) |
CNY 1200.00 |
|
| MR200546L3 | Lenti ORF clone of Atp6v1g1 (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1) |
CNY 4750.00 |
|
| MR200546L4 | Lenti ORF clone of Atp6v1g1 (mGFP-tagged) - Mouse ATPase, H+ transporting, lysosomal V1 subunit G1 (Atp6v1g1) |
CNY 4750.00 |
其它Atp6v1g1产品
