Tyw5 (NM_001114102) Mouse Untagged Clone
CAT#: MC210787
Tyw5 (untagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110034B05Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210787 representing NM_001114102
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGAGCAGCGTCTTCCGGTACCCCGGCTGCGGGGCGTCTCCCGGGAGCAGTTCATGGAGCATCTTT ATCCACAGAGAAAGCCTCTTGTGTTGGAAGGACTCGACTTAGGATCTTGTACAAGCAAATGGACAGTGGA TTACCTGAGTCAAGTTGGAGGAACGAAAGAAGTGAAAATTCACGTTGCTGCAGTTCCACAGATGGACTTC ATTAAACTTTACCTTTTAACAAGTTGGTCCAGAGAGCAGCCGAAGAAACACATAAAGAATTCTTCATTTC AGAGGATGAGAAATACTACTTACGGTCACTTGGAGAAGACCCAAGGAAGGATGTTGCAGACATCAGACAG CAGTTCCCATCATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001114102 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001114102.1, NP_001107574.1 |
RefSeq Size | 709 bp |
RefSeq ORF | 366 bp |
Locus ID | 68736 |
Gene Summary | tRNA hydroxylase that acts as a component of the wybutosine biosynthesis pathway. Wybutosine is a hyper modified guanosine with a tricyclic base found at the 3'-position adjacent to the anticodon of eukaryotic phenylalanine tRNA. Catalyzes the hydroxylation of 7-(a-amino-a-carboxypropyl)wyosine (yW-72) into undermodified hydroxywybutosine (OHyW*). OHyW* being further transformed into hydroxywybutosine (OHyW) by LCMT2/TYW4. OHyW is a derivative of wybutosine found in higher eukaryotes (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218860 | Tyw5 (tGFP-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik) transcript variant 2, (10ug) |
CNY 2090.00 |
|
MR218860 | Tyw5 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 2 |
CNY 1900.00 |
|
MR218860L3 | Lenti ORF clone of Tyw5 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 2 |
CNY 3800.00 |
|
MR218860L4 | Lenti ORF clone of Tyw5 (mGFP-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 2 |
CNY 3800.00 |