Cebpe (NM_207131) Mouse Untagged Clone
CAT#: MC212232
Cebpe (untagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe), (10ug)
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | C/EBPe; CRP1; Gm294 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212232 representing NM_207131
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCACGGGACCTACTATGAGTGCGAGCCTCGGGGTGGCCAGCAGCCACTTGAGTTCTCAGGGGGTC GAGCTGGGCCCGGGGAGCTGGGGGACATGTGTGAGCATGAGGCCTCCATCGACCTCTCCGCCTACATCGA GTCTGGGGAAGAACAGCTACTTTCTGACCTCTTTGCCATGAAGCCAACGCCTGAAGCCCGAAGCCTTAAG GGCCCAGGAGCCCCCTCGTTTCCTCACTACCTGCCGGCTGACCCTCGGCCATTCGCCTATCCCTCACACA CATTTGGCCCAGATAGGAAGGCTTTGGGGCCTGGCATCTACAGCAACCCAGGGAGCTACGACCCCAGGGC TGTGGCGGTGAAGGAGGAGCCTCGTGGGCCAGAGGGCAACCGAGGCACCAGTCGAGGCAGCTACAATCCC CTGCAGTACCAAGTGGCACACTGCGGGCAGACAGCCGTGCACCTCCCCCCGACCCTGGCAGCACCTGGCC AGCCCTTGCGTGTCCTCAAGGCCCCTGTGGCAGCTGCTGCCCCTCCCTGCAGTCCCCTTCTCAAGGCACC CTCCCCTGCTGGCCCCTCACACAAGGGCAAGAAGGCAGTGAACAAAGATAGCCTGGAGTACCGACTGCGA CGTGAACGTAACAACATCGCGGTGCGCAAGAGCCGGGACAAGGCCAAGAGGCGCATTATGGAGACTCAGC AGAAGGTCCTGGAGTACATGGCTGAAAACGAGCGTCTGCGCAACCGCGTAGACCAGCTCACTCAGGAGCT AGACACTCTGCGCAACCTCTTCCGCCAGATCCCTGAGGCTGCTAGCCTCATCAAGGGTGTCGGGGGCTGC AGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_207131 |
| Insert Size | 846 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_207131.1, NP_997014.1 |
| RefSeq Size | 1238 bp |
| RefSeq ORF | 846 bp |
| Locus ID | 110794 |
| UniProt ID | Q6PZD9 |
| Gene Summary | Transcriptional activator. C/EBP are DNA-binding proteins that recognize two different motifs: the CCAAT homology common to many promoters and the enhanced core homology common to many enhancers. Required for the promyelocyte-myelocyte transition in myeloid differentiation.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Macrophage ABHD5 promotes colorectal cancer growth by suppressing spermidine production by SRM
,Miao, H;Ou, J;Peng, Y;Zhang, X;Chen, Y;Hao, L;Xie, G;Wang, Z;Pang, X;Ruan, Z;Li, J;Yu, L;Xue, B;Shi, H;Shi, C;Liang, H;,
Nat Commun
,PubMed ID 27189574
[Cebpe]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG217079 | Cebpe (tGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP) epsilon (Cebpe), (10ug) |
CNY 4370.00 |
|
| MR217079 | Cebpe (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe) |
CNY 3600.00 |
|
| MR217079L1 | Lenti ORF clone of Cebpe (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe) |
CNY 5890.00 |
|
| MR217079L2 | Lenti ORF clone of Cebpe (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe) |
CNY 6000.00 |
|
| MR217079L3 | Lenti ORF clone of Cebpe (Myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe) |
CNY 5890.00 |
|
| MR217079L4 | Lenti ORF clone of Cebpe (mGFP-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), epsilon (Cebpe) |
CNY 5890.00 |
