Fer (NM_008000) Mouse Untagged Clone

CAT#: MC215932

Fert2 (untagged) - Mouse fer (fms/fps related) protein kinase, testis specific 2 (Fert2), transcript variant 2, (10ug)



  "NM_008000" in other vectors (4)

CNY 5800.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AV082135; C330004K01Rik; Fert; Fert2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215932 representing NM_008000
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATAAGAGTATGGAGTGTCCCCACTGTGAGGGTGTGCTGGAGCCTGAGTCTGACCCCCAGTTCTCTA
AAAAATGTTCTATACCATTGAGCCCTGGACCTTCCTCATCAGAGATCCTGAGATACAAGGAAAGAAAGGA
GAGGCTATCCAAATTTGAGTCTATTCGTCATTCAATTGCTGGGATAATTAAGTCTCCAAAGTCGGTACTC
GGATCTTCAACAGTGTGTGATGTGATCTCTGTGGGTGAGAGGCCCCTGGCGGAGCATGACTGGTACCATG
GTGCCATCCCCAGGATAGAGGCACAGGAACTGCTGAAGCAGCAAGGAGACTTCCTGGTGCGGGAGAGCCA
TGGGAAACCTGGTGAATATGTCCTTTCTGTATATTCTGACGGACAAAGGAGGCACTTTATCATACAATTT
GTCGATAATCTGTATCGATTCGAGGGCACCGGGTTTTCAAACATTCCCCAGCTTATAGATCACCACTTCA
ATACAAAGCAAGTCATCACCAAGAAGTCTGGGGTGGTTCTGCTCAACCCCATCCCAAAGGATAAGAAATG
GGTTCTCAATCATGAAGATGTTTCATTGGGAGAATTACTGGGCAAGGGGAATTTTGGTGAAGTGTATAAG
GGCACACTAAAGGATAAAACTCCTGTTGCCATTAAAACGTGCAAGGAAGACCTTCCTCAGGAATTAAAAA
TAAAGTTTCTACAGGAAGCCAAAATTCTGAAGCAATATGATCATCCCAATATTGTCAAACTGATAGGCGT
GTGCACACAAAGACAGCCTGTCTACATCATTATGGAACTGGTCCCAGGGGGTGATTTTCTGACCTTCCTG
AGGAAGAGGAAGGACGAGCTGAAGCTGAAGCAGTTGGTGAGATTTTCCTTGGACGTTGCTGCTGGCATGT
TGTATCTCGAGAGCAAGAACTGCATTCACAGGGACCTGGCTGCACGGAACTGCCTGGTGGGTGAAAATAA
TACTCTGAAAATCAGTGACTTTGGAATGTCTCGGCAAGAAGACGGTGGAGTGTATTCATCTTCTGGCTTA
AAGCAGATTCCTATTAAATGGACAGCACCGGAAGCTCTTAATTATGGGAGATACAGTTCTGAAAGTGACG
TGTGGAGCTTCGGCATCCTCCTCTGGGAGACCTTCAGCCTAGGAGTCTGCCCGTACCCTGGAATGACAAA
CCAGCAAGCGCGAGAGCAAGTGGAGAGAGGATACCGGATGTCAGCCCCACAGAACTGTCCAGAGGAGGTT
TTTACAATCATGATGAAGTGTTGGGATTACAAGCCTGAAAACCGCCCTAAGTTCAACGACCTTCACAAAG
AGCTCACTGTCATCAAGAAGATGATCACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008000
Insert Size 1362 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008000.2, NP_032026.2
RefSeq Size 2383 bp
RefSeq ORF 1362 bp
Locus ID 14158
UniProt ID P70451
Gene Summary Tyrosine-protein kinase that acts downstream of cell surface receptors for growth factors and plays a role in the regulation of the actin cytoskeleton, microtubule assembly, lamellipodia formation, cell adhesion, cell migration and chemotaxis. Acts downstream of EGFR, KIT, PDGFRA and PDGFRB. Acts downstream of EGFR to promote activation of NF-kappa-B and cell proliferation. May play a role in the regulation of the mitotic cell cycle. Plays a role in the insulin receptor signaling pathway and in activation of phosphatidylinositol 3-kinase. Acts downstream of the activated FCER1 receptor and plays a role in FCER1 (high affinity immunoglobulin epsilon receptor)-mediated signaling in mast cells. Plays a role in the regulation of mast cell degranulation. Plays a role in leukocyte recruitment and diapedesis in response to bacterial lipopolysaccharide (LPS). Phosphorylates CTTN, CTNND1, PTK2/FAK1, GAB1, PECAM1 and PTPN11. May phosphorylate JUP and PTPN1. Can phosphorylate STAT3 according to PubMed:10878010 and PubMed:19159681, but clearly plays a redundant role in STAT3 phosphorylation. According to PubMed:11134346, cells where wild type FER has been replaced by a kinase-dead mutant show no reduction in STAT3 phosphorylation. Phosphorylates TMF1. Isoform 3 lacks kinase activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, and has multiple differences in the coding region, compared to variant 1. The encoded isoform (b) has a distinct and shorter N-terminus and lacks an internal aa, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...