Epc1 (NM_001276350) Mouse Untagged Clone
CAT#: MC225489
Epc1 (untagged) - Mouse enhancer of polycomb homolog 1 (Drosophila) (Epc1), transcript variant 3
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2400007E14Rik; 5730566F07Rik; A930032N02Rik; mir-1893 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225489 representing NM_001276350
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTAAACTGTCGTTTCGGGCGCGGGCGCTGGACGCCTCGAAGCCGCTGCCGGTCTTCCGCTGTGAGG ATCTGCCCGACCTGCACGAATACGCCTCGATAAACCGGGCCGTGCCGCAGATGCCCACCGGGATGGAGAA GGAAGAGGAGTCGGTACAGCCACTTATACAGGGTGCAGTGTGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276350 |
Insert Size | 186 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001276350.1, NP_001263279.1 |
RefSeq Size | 834 bp |
RefSeq ORF | 186 bp |
Locus ID | 13831 |
UniProt ID | Q8C9X6 |
Gene Summary | Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks several exons in the central and 3' coding regions and includes an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR, compared to variant 2. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227700 | Epc1 (myc-DDK-tagged) - Mouse enhancer of polycomb homolog 1 (Drosophila) (Epc1), transcript variant 3 |
CNY 1900.00 |
Customer
Reviews
Loading...