Fabp5 (NM_001272098) Mouse Untagged Clone
CAT#: MC225515
Fabp5 (untagged) - Mouse fatty acid binding protein 5, epidermal (Fabp5), transcript variant 3
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | E-FABP; Fabpe; Kl; Klbp; ma; mal1; PA-FABP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225515 representing NM_001272098
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGTCTTAAGGATCTCGAAGGGAAGTGGCGCCTGATGGAAAGCCACGGCTTTGAGGAGTACATGA AAGAGCTAGACGGTCTGCACCTTCCAAGACGGTGCCCTGGTCCAGCACCAGCAATGGGACGGGAAGGAGA GCACGATAACAAGAAAACTGAAGGATGGGAAGATGATCGTGGAGTGTGTCATGAACAATGCCACCTGCAC TCGGGTCTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272098 |
Insert Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001272098.1, NP_001259027.1 |
RefSeq Size | 796 bp |
RefSeq ORF | 222 bp |
Locus ID | 16592 |
Gene Summary | The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. In humans this gene has been associated with psoriasis and type 2 diabetes. In mouse deficiency of this gene in combination with a deficiency in Fabp4 confers protection against atherosclerosis, diet-induced obesity, insulin resistance and experimental autoimmune encephalomyelitis (the mouse model for multiple sclerosis). Alternative splicing results in multiple transcript variants that encode different protein isoforms. The mouse genome contains many pseudogenes similar to this locus. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. Variant 3 lacks a large portion of the central coding region found in variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform lacks the lipocalin domain found in isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227726 | Fabp5 (myc-DDK-tagged) - Mouse fatty acid binding protein 5, epidermal (Fabp5), transcript variant 3 |
CNY 1900.00 |
Customer
Reviews
Loading...