Sumo3 (NM_001301672) Mouse Untagged Clone
CAT#: MC225609
Sumo3 (untagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3), transcript variant 3
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810014B19Rik; D10Ertd345; D10Ertd345e; SMT; SMT3A; Smt3h; Smt3h1; SUMO-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225609 representing NM_001301672
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGAAGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCGGGGC AGGATGGCTCGGTGGTACAGTTCAAGATCAAGAGGCACACCCCACTGAGCAAGCTGATGAAGGCCTACTG TGAGAGGCAGGGCTTGTCAATGAGGCAGATTCGATTCCGGTTTGATGGACAACCAATCAATGAAACAGAC ACTCCAGCCCAGCAGACAGGAGGATCAGCCTCCCGAGGGAGCGTCCCCACACCCAACCGTTGTCCTGACC TGTGCTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301672 |
Insert Size | 291 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001301672.1, NP_001288601.1 |
RefSeq Size | 2588 bp |
RefSeq ORF | 291 bp |
Locus ID | 20610 |
UniProt ID | Q9Z172 |
Gene Summary | This gene encodes a member of the small ubiquitin-like modifier family. The encoded protein may regulate a variety of proteins in many pathways via a post-translational modification, known as SUMOylation. This activity may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Disruption of some of these processes has been associated with cerebral ischemia, neural dysfunction, and heart disease. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227820 | Sumo3 (myc-DDK-tagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3), transcript variant 3 |
CNY 1900.00 |
Customer
Reviews
Loading...