Sigmar1 (NM_001286605) Mouse Untagged Clone
CAT#: MC225658
Sigmar1 (untagged) - Mouse sigma non-opioid intracellular receptor 1 (Sigmar1), transcript variant 8
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | mSig; O; Oprs1; Si; Sig1R; sigma1R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225658 representing NM_001286605
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGTGGGCCGCGGGACGGCGGTGGGCATGGATCACCCTGATTCTGACTATTATCGCAGTGCTGATCC AGGCCGCCTGGTTGTGGCTGGGCACTCAAAACTTCGTCTTCTCTAGAGAAGAAATAGCGCAGCTTGCTCG ACAGTATGCGGGGCTGGACCATGAGCTTGCCTTCTCTCGGCTGATCGTGGAGCTGCGGAGGCTGCACCCA GGCCACGTGCTGCCGGATGAGGAGCTGCAGTGGGTATTTGTGAACGCGGGCGGCTGGATGGGCGCCATGT GTATTCTGCACGCCTCGCTGTCTGAGACGATACTGGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286605 |
Insert Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286605.1, NP_001273534.1 |
RefSeq Size | 1463 bp |
RefSeq ORF | 321 bp |
Locus ID | 18391 |
Gene Summary | This gene encodes a transmembrane protein located in the endoplasmic reticulum. The encoded protein is a receptor that binds several endogenous ligands, including N,N-dimethyltryptamine, progesterone and pregnenolone and a variety of of non-opiate compounds. The encoded protein plays a role in regulating the activity of ion channels, acting as a chaperone and protecting cells from oxidative stress. In humans, this receptor has been associated with Alzheimer's and Parkinson's diseases, stroke and numerous disease conditions such as depression, pain and addiction. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2013] Transcript Variant: This variant (8) differs in the 3' UTR and uses an alternate splice site in the coding region which results in a frameshift compared to variant 1. The encoded protein (isoform 7; also known as short form sigma1R) is shorter and has a distinct C-terminus compared to isoform 1. Variants 7 and 8 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227869 | Sigmar1 (myc-DDK-tagged) - Mouse sigma non-opioid intracellular receptor 1 (Sigmar1), transcript variant 8 |
CNY 1900.00 |
其它Sigmar1产品
Customer
Reviews
Loading...