Anapc15 (NM_001291353) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	3200002M19Rik; 6330414C15Rik; APC15
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225817 representing NM_001291353 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCAGGACTCAAACTCAGCTTAGGAGCCATGTCCACCTTGTTCCCGTCACTCTTCCCTCGTGTGA CTGAGACACTGTGGTTTAATCTGGACCGACCCTGTGTGGAGGAGACAGAGCTGCAGCAGCAGGAGCAGCA GCATCAGGCCTGGCTCCAAAGCATCGCAGAGAAAGACAACAACCTGGTACCAATTGGCAAGCCGGCCTCA GAGCACTACGATGATGAGGAAGAAGAGGATGATGAAGATGATGAGGACAGTGAAGAGGATTCCGAAGATG ATGAGGACATGCAAGACATGGATGAGATGAATGACTATAATGAGTCACCTGATGATGGAGAGGTCAATGA GGTGGACATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001291353
Insert Size	399 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001291353.1, NP_001278282.1
RefSeq Size	843 bp
RefSeq ORF	399 bp
Locus ID	75430
UniProt ID	P60007
Gene Summary	Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate splice junction at the 3' end of one exon and at the 5' end of the next exon compared to variant 1. The resulting isoform (c) has a shorter and distinct N-terminus compared to isoform a. Variants 3, 4, and 5 all encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.