Cnot7 (NM_001271543) Mouse Untagged Clone

CAT#: MC226557

Cnot7 (untagged) - Mouse CCR4-NOT transcription complex, subunit 7 (Cnot7), transcript variant 3



  "NM_001271543" in other vectors (1)

CNY 2380.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CNOT7 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU022737; CAF-1; Caf1; Pop2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226557 representing NM_001271543
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGCAGCAACCGTAGATCATAGCCAAAGAATTTGTGAAGTTTGGGCTTGTAACCTGGATGAAGAGA
TGAAGAAAATCCGTCAAGTTATCCGAAAATATAATTATGTTGCTATGGACACCGAGTTTCCAGGCGTTGT
TGCAAGACCCATTGGAGAATTCAGAAGCAATGCTGACTATCAGTACCAACTGTTGCGGTGTAATGTAGAC
TTGTTAAAGATAATCCAGCTCGGACTGACCTTTATGAATGAACAGGGAGAATACCCTCCAGGAACGTCAA
CTTGGCAGTTTAACTTTAAGTTTAATTTGACGGAGGACATGTATGCTCAGGACTCTATAGAGCTACTAAC
AACATCTGGTATCCAGTTTAAAAAACACGAGGAGGAAGGAATTGAGACCCAATATTTTGCAGAACTTCTT
ATGACTTCAGGAGTGGTTCTTTGTGAAGGGGTCAAATGGCTATCATTTCACAGTGGTTATGACTTTGGCT
ATTTAATCAAAATTCTGACCAACTCTAACTTGCCTGAGGAAGAACTTGATTTCTTTGAGATCCTTCGGTT
ATTTTTTCCTGTCATTTATGATGTGAAGTACCTCATGAAGAGCTGCAAAAATCTCAAAATGTTCTTTGAA
GATCACATTGATGATGCCAAATACTGTGGTCACTTATATGGCCTTGGTTCTGGCTCATCCTATGTACAGA
ACGGCACAGGGAATGCATATGAAGAGGAAGCCAGCAAGCAGTCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271543
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271543.1, NP_001258472.1
RefSeq Size 2506 bp
RefSeq ORF 747 bp
Locus ID 18983
Gene Summary Has 3'-5' poly(A) exoribonuclease activity for synthetic poly(A) RNA substrate. Its function seems to be partially redundant with that of CNOT8. Catalytic component of the CCR4-NOT complex which is one of the major cellular mRNA deadenylases and is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. During miRNA-mediated repression the complex seems also to act as translational repressor during translational initiation. Additional complex functions may be a consequence of its influence on mRNA expression. Required for miRNA-mediated mRNA deadenylation. Associates with members of the BTG family such as TOB1 and BTG2 and is required for their anti-proliferative activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...