Bdnf (NM_001285416) Mouse Untagged Clone

CAT#: MC226566

Bdnf (untagged) - Mouse brain derived neurotrophic factor (Bdnf), transcript variant 5



  "NM_001285416" in other vectors (1)

CNY 2570.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226566 representing NM_001285416
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCGGTTGCATGAAGGCGGCGCCCATGAAAGAAG
TAAACGTCCACGGACAAGGCAACTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGCGTGAA
TGGGCCCAGGGCAGGTTCGAGAGGTCTGACGACGACATCACTGGCTGACACTTTTGAGCACGTCATCGAA
GAGCTGCTGGATGAGGACCAGAAGGTTCGGCCCAACGAAGAAAACCATAAGGACGCGGACTTGTACACTT
CCCGGGTGATGCTCAGCAGTCAAGTGCCTTTGGAGCCTCCTCTACTCTTTCTGCTGGAGGAATACAAAAA
TTACCTGGATGCCGCAAACATGTCTATGAGGGTTCGGCGCCACTCCGACCCTGCCCGCCGTGGGGAGCTG
AGCGTGTGTGACAGTATTAGCGAGTGGGTCACAGCGGCAGATAAAAAGACTGCAGTGGACATGTCTGGCG
GGACGGTCACAGTCCTAGAGAAAGTCCCGGTATCCAAAGGCCAACTGAAGCAGTATTTCTACGAGACCAA
GTGTAATCCCATGGGTTACACCAAGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAATGC
CGAACTACCCAATCGTATGTTCGGGCCCTTACTATGGATAGCAAAAAGAGAATTGGCTGGCGATTCATAA
GGATAGACACTTCCTGTGTATGTACACTGACCATTAAAAGGGGAAGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285416
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001285416.1, NP_001272345.1
RefSeq Size 4078 bp
RefSeq ORF 750 bp
Locus ID 12064
UniProt ID P21237
Gene Summary The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (5) differs in the 5' UTR and coding region, and uses a downstream translation start compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus compared to isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...