Npm1 (NM_001252260) Mouse Untagged Clone

CAT#: MC226750

Npm1 (untagged) - Mouse nucleophosmin 1 (Npm1), transcript variant 2



  "NM_001252260" in other vectors (1)

CNY 2,760.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
NPM1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms B23; NO38; Npm
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226750 representing NM_001252260
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGTGGATAATGATG
AAAATGAGCACCAGTTGTCATTAAGAACGGTCAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGT
AGAGGCAGAAGCAATGAACTATGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTA
CAACCAACAGTTTCCCTAGGGGGCTTTGAAATTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAG
GGCCTGTGCACATTAGTGGACAGCATCTAGTAGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGA
GGAGGACGTAAAACTCTTAGGCATGTCTGGAAAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAG
AAAAAAGTAAAACTTGATGAAGATGATGAGGACGATGATGAGGACGATGAGGATGATGAGGATGATGATG
ATGATGATTTTGATGAAGAGGAAACTGAAGAAAAGGTCCCAGTGAAGAAATCTGTACGAGATACCCCAGC
CAAAAATGCACAAAAATCAAACCAAAATGGAAAAGACTTAAAACCATCAACACCGAGATCAAAGGGTCAA
GAGTCCTTCAAAAAACAGGAAAAGACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACATTAAGG
CAAAAATGCAAGCAAGTATAGAAAAAGGCGGTTCTCTTCCCAAAGTGGAAGCCAAGTTCATTAATTATGT
GAAGAATTGTTTCCGGATGACTGACCAGGAGGCTATTCAAGATCTCTGGCAGTGGAGGAAATCTCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252260
Insert Size 840 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252260.1, NP_001239189.1
RefSeq Size 1401 bp
RefSeq ORF 840 bp
Locus ID 18148
Gene Summary Involved in diverse cellular processes such as ribosome biogenesis, centrosome duplication, protein chaperoning, histone assembly, cell proliferation, and regulation of tumor suppressors p53/TP53 and ARF. Binds ribosome presumably to drive ribosome nuclear export. Associated with nucleolar ribonucleoprotein structures and bind single-stranded nucleic acids. Acts as a chaperonin for the core histones H3, H2B and H4. Stimulates APEX1 endonuclease activity on apurinic/apyrimidinic (AP) double-stranded DNA but inhibits APEX1 endonuclease activity on AP single-stranded RNA. May exert a control of APEX1 endonuclease activity within nucleoli devoted to repair AP on rDNA and the removal of oxidized rRNA molecules. In concert with BRCA2, regulates centrosome duplication. Regulates centriole duplication: phosphorylation by PLK2 is able to trigger centriole replication. Negatively regulates the activation of EIF2AK2/PKR and suppresses apoptosis through inhibition of EIF2AK2/PKR autophosphorylation. Antagonizes the inhibitory effect of ATF5 on cell proliferation and relieves ATF5-induced G2/M blockade. In complex with MYC enhances the transcription of MYC target genes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an in-frame segment in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...