Fut1 (NM_001271981) Mouse Untagged Clone

CAT#: MC227027

Fut1 (untagged) - Mouse fucosyltransferase 1 (Fut1), transcript variant 2



  "NM_001271981" in other vectors (1)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
FUT1 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MFUT-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227027 representing NM_001271981
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTATGCCTACCTCATCCATTGCAGACATCTAATGGCTCCCCTTCCTGTCCTGAGCAGTCCTCCTCAC
TCTCTGGGACTTGGACAATCACCCCAGGAGGCAGGTTTGGTAACCAGATGGGGCAGTATGCTACATTGCT
GGCCCTAGCCCAGCTCAATGGTCGCCAAGCCTTCATCCAACCTGAGATGCATGCCGCCCTGGCCCCCGTG
TTCCGAATCTCCCTGCCAGTGCTGGACCCTGAGGTGGACAGCCTCACACCTTGGCAGCACTTAGTCCTAC
ATGACTGGATGTCAGAGGAGTACTCCCATCTGGAGGACCCATTTCTCAAGCTGTCTGGTTTCCCCTGCTC
TTGGACCTTTTTCCATCATCTTCGGGAACAGATTCGTAGGGAATTCACTCTGCATAACCATCTACGGGAA
GGTGCCCAGTACCTGTTGAGCGGGCTCCGTATAGGCCCGGCGGGCATCCGCCCTCATACCTTTGTGGGTG
TCCATGTGCGTCGTGGAGACTATCTGGAGGTGATGCCCAATCGCTGGAAGGGTGTGGTGGGTGACCGAGC
TTACCTCCAGCAAGCCATGGACTGGTTCCGGGCCCGACACAAAGACCCCATCTTTGTGGTCACCAGCAAT
GGCATGAAATGGTGTTTGGAGAACATTGACACATCCCATGGTGATGTGGTCTTCGCTGGCAATGGACAGG
AGGGTACACCGGGGAAGGACTTTGCACTTCTCACACAGTGTAACCACACCATCATGACTATTGGCACCTT
TGGCTTCTGGGCTGCCTACTTAGCTGGTGGAGACACGGTCTACCTTGCAAACTTCACCCTGCCAGATTCG
GAGTTTCTGAAGATCTTCAGGCCTGAGGCTGCCTTCCTGCCTGAGTGGGTGGGCATCAATGCAGACTTGT
CCCCGCTGCAGGCTCAATTTGACCCCTGGAAGCCAGACAGTCTTTTTAGATTGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271981
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271981.1, NP_001258910.1
RefSeq Size 2442 bp
RefSeq ORF 969 bp
Locus ID 14343
UniProt ID O09160
Gene Summary This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) uses an alternate splice site at the 5' end of the coding exon and uses an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...