E2f3 (NM_001289920) Mouse Untagged Clone

CAT#: MC227099

E2f3 (untagged) - Mouse E2F transcription factor 3 (E2f3), transcript variant 2



  "NM_001289920" in other vectors (1)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms E2f3a; E2F3b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227099 representing NM_001289920
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCTTACAGCAGCAGGCAAAGCGAAGGCTGGAACTGGGCGAGAGTGGCCATCAGTACCTCTCAGATG
GTCTAAAGACCCCCAAGGGCAAAGGAAGAGCTGCACTACGGAGTCCCGATAGTCCAAAAAAAAAAACGCG
GTATGATACGTCCCTCGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCTCCTGATGGGGTC
CTGGATCTGAACAAGGCAGCAGAGGTGCTCAAGGTGCAGAAGAGGAGGATTTACGACATCACCAACGTGC
TGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAGAACAACGTCCAGTGGATGGGCTGCAGTCTGTCTGA
GGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCCAAAGAAGTGACTGAGCTCAGTCAGGAAGAGAAG
AAATTAGATGAGCTGATCCAAAGCTGTACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAA
GGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGT
GAAAGCCCCTCCAGAAACGAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATCCATTTGGCAAGT
ACCCAAGGGCCCATTGAGGTTTACTTGTGTCCAGAAGAGACGGAAACACACAGACCCATGAAAACAAATA
ACCAAGACCACAATGGGAATATCCCCAAGCCCACTTCCAAAGACTTGGCTTCTAACAACTCAGGACATAG
TGACTGCTCGGTTTCTACAGCAAACCTCTCTCCTCTGGCCTCCCCAGCCAACCTTTTACAGCAGACTGAG
GACCAAATCCCGTCCAACCTTGAAGGACCTTTTGTGAACTTACTGCCTCCCCTGCTCCAAGAGGACTACC
TGCTGAGCCTGGGGGAGGAAGAGGGCATCAGTGACCTCTTCGATGCCTATGATTTGGAAAAGCTGCCTCT
GGTGGAGGACTTCATGTGTAGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289920
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289920.1, NP_001276849.1
RefSeq Size 4588 bp
RefSeq ORF 1005 bp
Locus ID 13557
Gene Summary Transcription activator that binds DNA cooperatively with DP proteins through the E2 recognition site, 5'-TTTC[CG]CGC-3' found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The DRTF1/E2F complex functions in the control of cell-cycle progression from G1 to S phase. E2F3 binds specifically to RB1 in a cell-cycle dependent manner. Inhibits adipogenesis, probably through the repression of CEBPA binding to its target gene promoters (PubMed:20176812).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2, also known as E2f3b) differs in the 5' UTR and the 5' coding region and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform E2f3b, which is shorter and has a distinct N-terminus, compared to isoform E2f3a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...