Lpar1 (NM_001290486) Mouse Untagged Clone

CAT#: MC227182

Lpar1 (untagged) - Mouse lysophosphatidic acid receptor 1 (Lpar1), transcript variant 3



  "NM_001290486" in other vectors (1)

CNY 3330.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI326300; Edg2; Gpcr26; Kdt2; lpA1; vzg-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227182 representing NM_001290486
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGAACAACAGTGCTTCTACAATGAGTCTATCGCCTTCTTTTATAACCGGAGTGGGAAATATCTAG
CCACAGAATGGAACACAGTGAGCAAGCTGGTGATGGGACTGGGCATCACTGTTTGCGTGTTCATCATGTT
GGCCAATCTCCTGGTCATGGTGGCAATCTACGTCAACCGCCGCTTCCATTTCCCTATTTATTACTTGATG
GCCAACCTGGCTGCTGCAGACTTCTTCGCTGGATTGGCCTACTTCTACCTGATGTTCAATACAGGACCTA
ATACCCGGAGACTGACTGTTAGCACGTGGCTCCTCCGGCAGGGCCTCATTGACACCAGCCTGACAGCTTC
TGTGGCCAACCTGCTGGCTATTGCTATCGAGAGGCACATCACGGTTTTCCGCATGCAGCTCCATACACGA
ATGAGCAACCGGCGCGTGGTGGTGGTGATTGTAGTCATCTGGACTATGGCCATTGTGATGGGTGCTATAC
CCAGTGTGGGCTGGAACTGCATCTGTGATATCGATCACTGTTCCAACATGGCACCCCTCTACAGTGACTC
CTACTTAGTCTTCTGGGCCATTTTCAACCTGGTGACCTTTGTGGTCATGGTGGTTCTCTACGCTCACATC
TTTGGCTATGTTCGCCAGAGGACTATGAGGATGTCTCGGCATAGTTCTGGACCCAGGAGGAATCGGGACA
CCATGATGAGCCTTCTGAAGACTGTGGTCATTGTGCTTGGTGCCTTTATTGTCTGCTGGACTCCGGGATT
GGTCTTGTTATTGCTGGATGTGTGCTGCCCGCAGTGCGATGTCCTGGCCTATGAGAAGTTCTTCCTCCTC
CTGGCCGAGTTCAACTCTGCTATGAACCCCATCATCTACTCCTACCGCGACAAAGAGATGAGCGCCACCT
TCAGGCAGATCCTGTGTTGCCAGCGCAACGAGAACCCTAATGGCCCCACGGAAGGCTCTGACCGCTCTGC
CTCCTCCCTCAACCACACCATTCTGGCTGGAGTTCACAGCAACGACCACTCTGTGGTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290486
Insert Size 1041 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290486.1, NP_001277415.1
RefSeq Size 3247 bp
RefSeq ORF 1041 bp
Locus ID 14745
UniProt ID P61793
Gene Summary Receptor for lysophosphatidic acid (LPA) (PubMed:11087877, PubMed:18066075). Plays a role in the reorganization of the actin cytoskeleton, cell migration, differentiation and proliferation, and thereby contributes to the responses to tissue damage and infectious agents. Activates downstream signaling cascades via the G(i)/G(o), G(12)/G(13), and G(q) families of heteromeric G proteins (PubMed:8922387, PubMed:9600933, PubMed:11040035, PubMed:18157949, PubMed:18066075, PubMed:23478264). Signaling inhibits adenylyl cyclase activity and decreases cellular cAMP levels (PubMed:11040035, PubMed:12215548). Signaling triggers an increase of cytoplasmic Ca(2+) levels (PubMed:12215548). Activates RALA; this leads to the activation of phospholipase C (PLC) and the formation of inositol 1,4,5-trisphosphate (PubMed:11040035, PubMed:12215548, PubMed:23478264). Signaling mediates activation of down-stream MAP kinases (PubMed:11040035). Contributes to the regulation of cell shape (PubMed:8922387, PubMed:9600933, PubMed:11040035, PubMed:11087877). Promotes Rho-dependent reorganization of the actin cytoskeleton in neuronal cells and neurite retraction (PubMed:9600933, PubMed:11040035, PubMed:12181339). Promotes the activation of Rho and the formation of actin stress fibers (PubMed:9600933, PubMed:12215548). Promotes formation of lamellipodia at the leading edge of migrating cells via activation of RAC1 (PubMed:23478264). Through its function as lysophosphatidic acid receptor, plays a role in chemotaxis and cell migration, including responses to injury and wounding (PubMed:11087877, PubMed:18066075, PubMed:23478264). Plays a role in triggering inflammation in response to bacterial lipopolysaccharide (LPS) via its interaction with CD14 (PubMed:21821728). Promotes cell proliferation in response to lysophosphatidic acid (PubMed:9600933, PubMed:11087877, PubMed:12215548, PubMed:18157949, PubMed:17692995, PubMed:23478264). Required for normal skeleton development (PubMed:21569876). May play a role in osteoblast differentiation (PubMed:21569876). Required for normal brain development (PubMed:17656621, PubMed:18708146). Required for normal proliferation, survival and maturation of newly formed neurons in the adult dentate gyrus (PubMed:18708146). Plays a role in pain perception and in the initiation of neuropathic pain (PubMed:15195086, PubMed:19689455).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate 5' terminal exon and initiates translation at a downstream start codon, compared to variant 2. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...