Sox17 (NM_001289466) Mouse Untagged Clone

CAT#: MC227240

Sox17 (untagged) - Mouse SRY (sex determining region Y)-box 17 (Sox17), transcript variant 4



  "NM_001289466" in other vectors (1)

CNY 3420.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227240 representing NM_001289466
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACCTCATGGATACAATGAGCAGCACCTCCAGACATCTGAATTTCAGCCTTCCTATTTCCCCAAGA
GGTCTTGGCGCCAGCGCCCGGCTCCAGCCAGTTTTCCCCAAGGCAAGTCTTGGAAGGCGTTGACCTTGGC
AGAGAAGCGGCCCTTCGTGGAAGAGGCCGAGCGGCTGCGCGTGCAGCATATGCAGGACCACCCCAACTAC
AAGTACCGGCCGCGGCGGCGCAAGCAGGTGAAGCGCATGAAGCGGGTGGAGGGAGGCTTCCTGCACGCTC
TCGTCGAGCCCCAGGCCGGCGCGCTTGGTCCCGAGGGCGGCCGCGTGGCCATGGATGGCCTGGGTCTGCC
TTTCCCGGAGCCGGGCTATCCGGCCGGTCCTCCGCTGATGTCTCCGCACATGGGCCCCCACTATCGGGAC
TGCCAGGGACTGGGCGCTCCCGCGCTCGACGGCTACCCTCTGCCCACTCCGGACACATCCCCGCTGGATG
GCGTGGAGCAGGACCCGGCTTTCTTTGCAGCCCCGCTGCCAGGGGACTGCCCGGCGGCCGGCACCTACAC
TTACGCTCCAGTCTCGGACTATGCAGTGTCCGTAGAGCCGCCCGCTGGCCCCATGCGAGTGGGGCCGGAC
CCCTCGGGCCCTGCGATGCCGGGGATCCTGGCGCCCCCCAGCGCTCTGCACCTGTACTACGGCGCGATGG
GCTCGCCCGCCGCAAGTGCGGGGCGCGGTTTCCACGCGCAACCCCAGCAGCCGCTGCAACCGCAGGCACC
GCCGCCGCCACCGCAGCAGCAGCACCCAGCGCACGGCCCCGGGCAACCTTCGCCCCCTCCCGAGGCTCTG
CCCTGCCGGGATGGCACGGAATCCAACCAGCCCACTGAGCTCCTAGGGGAGGTGGACCGCACGGAATTCG
AACAGTATCTGCCCTTTGTGTATAAGCCCGAGATGGGTCTTCCCTACCAGGGACACGACTGCGGAGTGAA
CCTCTCAGACAGCCACGGAGCCATTTCCTCCGTGGTGTCCGACGCTAGCTCAGCGGTCTACTATTGCAAC
TACCCCGACATTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289466
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289466.1, NP_001276395.1
RefSeq Size 2960 bp
RefSeq ORF 1065 bp
Locus ID 20671
Gene Summary This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Variants 3 and 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...