Cbfa2t2 (NM_001285446) Mouse Untagged Clone

CAT#: MC227369

Cbfa2t2 (untagged) - Mouse core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) (Cbfa2t2), transcript variant 3



  "NM_001285446" in other vectors (1)

CNY 3610.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-Cbfa2t2 antibody
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A430091M07; C330013D05Rik; Cbfa2t2h; MTGR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227369 representing NM_001285446
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGTTCATGGAAATGGAAAGAGGCCCAGTCCGGAAAGGAGGGACGAGAATAATTTTGAAAGAGATA
CAGTTCCTCCTGAACCGCCTGCCAAGAGAGTGTGTACTATCAGCCCTGCTCCTCGGCACAGTCCCGCCCT
CACTGTTCCCCTTATGAATCCTGGGGGCCAGTTCCATCCTACTCCACCACCTCTTCAGCACTATACACTA
GAAGACATTGCAACTTCTCACCTGTATCGGGAACCAAACAAGATGCTAGAACACCGAGAAGTTCGTGAGA
GGCACCACAATCTTAGTCTCAATGGAGGCTATCAAGATGAGTTGGTAGACCACCGTTTGACAGAAAGGGA
GTGGGCTGATGAATGGAAACACCTTGACCATGCACTGAATTGCATTATGGAAATGGTAGAGAAAACTAGG
CGCTCCATGGCAGTTCTGAGGCGCTGTCAGGAATCTGACCGTGAAGAACTCAACTATTGGAAACGGCGGT
TTAATGAAAATACAGAGTTGAGGAAAACTGGGACTGAGTTGGTCTCTAGGCAGCACAGCCCTGGGAGTAC
AGATTCTCTCAGCAACGATTCTCAGCGGGAATTTACCAGTAGACCAGCAACAGGATATGTGCCTGTGGAG
TTTTGGAAGAAAACAGAAGAAGCCGTGAATAAGGTGAAAATTCAGGCCATGTCAGAGGTACAGAAGGCTG
TAGCTGAGGCAGAGCAAAAAGCCTTTGAAGTGATTGCAACGGAGAGAGCTCGAATGGAGCAGACCATAGC
GGATGTCAAACGGCAGGCTGCAGAAGATGCTTTCCTGGTCATCAATGAGCAAGAAGAGTCCACAGAGAAC
TGCTGGAACTGTGGCCGAAAAGCCAGTGAGACGTGCAGTGGCTGCAACATTGCTCGCTACTGCGGCTCCT
TCTGCCAGCATAAGGACTGGGAGCGGCACCACCGCCTCTGTGGCCAGAGTCTACATGGCCACAGTCCCCA
CAGCCAGAGCAGGCCACTGCTCCCTGGAGGGCGGGGCTCAGCCAGGTCTGCTGACTGCAGTGTGCCCAGC
CCAGCCCTGGACAAGACCTCAGCTACCACCTCACGGTCCTCAACACCTGCCTCTGTGACAGCCATTGATG
CCAACGGGCTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285446
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001285446.1, NP_001272375.1
RefSeq Size 6076 bp
RefSeq ORF 1134 bp
Locus ID 12396
Gene Summary Transcriptional corepressor which facilitates transcriptional repression via its association with DNA-binding transcription factors and recruitment of other corepressors and histone-modifying enzymes. Via association with PRDM14 is involved in regulation of embryonic stem cell (ESC) pluripotency. Involved in primordial germ cell (PCG) formation (PubMed:27281218). Stabilizes PRDM14 and OCT4 on chromatin in a homooligomerization-dependent mannerCan repress the expression of MMP7 in a ZBTB33-dependent manner (By similarity). Through heteromerization with CBFA2T3/MTG16 may be involved in regulation of the proliferation and the differentiation of erythroid progenitors by repressing the expression of TAL1 target genes (PubMed:19799863). Required for the maintenance of the secretory cell lineage in the small intestine (PubMed:16227606). Can inhibit Notch signaling probably by association with RBPJ and may be involved in GFI1-mediated Paneth cell differentiation (PubMed:25398765).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site and uses a downstream start codon compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...