Btrc (NM_001286466) Mouse Untagged Clone

CAT#: MC227414

Btrc (untagged) - Mouse beta-transducin repeat containing protein (Btrc), transcript variant 4



  "NM_001286466" in other vectors (1)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Btrc Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms b-TrCP; beta-TrCP; Beta-Trcp1; E3RS-IkappaB; E3RSIkappaB; Fbw1a; FWD1; HOS; Slimb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227414 representing NM_001286466
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGTGGAAAAAGCTCATCGAGAGGATGGTCAGGACGGACTCTCTGTGGCGAGGCCTGGCAGAGCGCA
GAGGCTGGGGACAGTACTTATTCAAAAACAAACCTCCTGATGAGAACGCTCCTCCCAACTCCTTTTATAG
AGCGCTTTATCCTAAAATCATACAAGACATTGAGACAATAGAGTCCAATTGGAGATGTGGGCGACATAGT
TTACAGAGAATCCACTGCCGGAGTGAAACAAGTAAAGGGGTTTACTGTTTACAGTACGACGACCAGAAGA
TAGTCAGCGGCCTTCGAGACAACACCATCAAGATCTGGGATAAAAGCACACTGGAATGCAAGCGGATTCT
CACGGGCCACACGGGCTCCGTCCTGTGTCTGCAGTACGATGAGAGGGTGATCATCACAGGCTCCTCAGAC
TCCACCGTCAGAGTGTGGGATGTAAATGCAGGTGAGATGCTAAACACATTGATTCACCACTGTGAAGCCG
TTCTGCACCTGCGCTTCAATAATGGCATGATGGTGACCTGTTCCAAAGACCGTTCCATCGCTGTGTGGGA
TATGGCTTCCCCAACTGACATCACCCTCAGGAGGGTGCTGGTGGGACACCGAGCTGCGGTCAATGTTGTA
GACTTTGATGACAAGTACATCGTTTCTGCCTCTGGAGATAGAACCATAAAGGTGTGGAACACAAGTACCT
GTGAATTCGTAAGGACCCTAAATGGGCACAAGCGTGGCATCGCCTGTTTGCAGTACAGAGACAGGCTGGT
GGTGAGCGGCTCCTCTGACAACACCATCAGGCTGTGGGACATAGAGTGTGGAGCATGCCTGCGAGTGTTG
GAGGGCCATGAGGAGTTGGTACGCTGCATTCGATTTGATAACAAAAGGATAGTGAGCGGAGCCTATGATG
GGAAAATTAAAGTGTGGGATCTTATGGCTGCTTTGGACCCGCGTGCTCCAGCAGGGACTCTCTGTCTGCG
GACACTTGTGGAGCATTCTGGAAGAGTTTTCCGCCTCCAGTTTGATGAATTCCAGATTGTCAGTAGTTCA
CATGATGACACAATTCTCATCTGGGACTTCCTGAATGATCCAGCTGCTCACGCTGAACCGCCCCGCTCCC
CTTCTCGGACATACACCTACATCTCCAGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286466
Insert Size 1152 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286466.1, NP_001273395.1
RefSeq Size 6126 bp
RefSeq ORF 1152 bp
Locus ID 12234
UniProt ID Q3ULA2
Gene Summary Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Recognizes and binds to phosphorylated target proteins (PubMed:10097128, PubMed:16371461, PubMed:18782782, PubMed:9859996, PubMed:9990853, PubMed:21911472). SCF(BTRC) mediates the ubiquitination of phosphorylated NFKB, ATF4, CDC25A, DLG1, FBXO5, PER1, SMAD3, SMAD4, SNAI1 and probably NFKB2. SCF(BTRC) mediates the ubiquitination of CTNNB1 and participates in Wnt signaling (By similarity). SCF(BTRC) mediates the ubiquitination of NFKBIA, NFKBIB and NFKBIE; the degradation frees the associated NFKB1 to translocate into the nucleus and to activate transcription (PubMed:9859996, PubMed:10097128). Ubiquitination of NFKBIA occurs at 'Lys-21' and 'Lys-22' (PubMed:9859996, PubMed:10097128). SCF(BTRC) mediates the ubiquitination of CEP68; this is required for centriole separation during mitosis (By similarity). SCF(BTRC) mediates the ubiquitination and subsequent degradation of nuclear NFE2L1 (PubMed:21911472). Has an essential role in the control of the clock-dependent transcription via degradation of phosphorylated PER1 and PER2 (PubMed:18782782). May be involved in ubiquitination and subsequent proteasomal degradation through a DBB1-CUL4 E3 ubiquitin-protein ligase (By similarity). Required for activation of NFKB-mediated transcription by IL1B, MAP3K14, MAP3K1, IKBKB and TNF (By similarity). Required for proteolytic processing of GLI3 (PubMed:16371461). Mediates ubiquitination of REST, thereby leading to its proteasomal degradation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...