Txk (NM_001289495) Mouse Untagged Clone

CAT#: MC227868

Txk (untagged) - Mouse TXK tyrosine kinase (Txk), transcript variant 4



  "NM_001289495" in other vectors (1)

CNY 4560.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A130089B16Rik; Btkl; PTK-RL-18; PTK4; Rlk
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227868 representing NM_001289495
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAAAACTCAATCCAACAGAGGCGGGGTGCAACCCTCGAAGCGCAAGCCGCTGCCCCCCCTCCCGC
AGGAGCCTCCAGATGAGAGAATCCAGGTCAAGGCTCTTTATGACTTCCTGCCTCGGGAGCCTGGTAATTT
GGCACTGAAGAGAGCGGAGGAATATCTGATATTGGAGAGGTGTGATCCTCACTGGTGGAAGGCCAGAGAC
CGCTTCGGGAATGAAGGCTTAATCCCAAGCAACTATGTGACAGAAAACAGACTCGCCAACTTAGAAATCT
ATGAATGGTACCACAAGAACATTACGAGAAACCAGACCGAACGCCTATTGAGGCAAGAGGCTAAAGAAGG
TGCCTTTATCGTGAGAGATTCGAGACACTTGGGGTCTTACACAATCTCTGTGTTTACAAGAGCTCGAAGG
CATACACAGTCTTCAATAAAACATTATCAGATAAAAAAGAATGACTCCGGACAGTGGTACATCACCGAAA
GACATCTCTTCCCCTCAGTCCCCGAGTTGATCCAGTATCACCAGTACAATGCAGCTGGTCTCATATCTCG
TCTCCGCTATCCCATTGGGCTCCTGGGCAGCTGTTTACCAGCCACATCTGGTTTTAGCTATGAAAAGTGG
GAGATAGATCCATCAGAGTTGGCTTTTGTCAAGGAGATCGGAAGTGGTCAGTTTGGGGTTGTCCACTTAG
GAGAATGGAGAGCACATATCCCGGTCGCCATCAAGGCCATCAATGAAGGTTCCATGTCTGAAGAAGACTT
CATTGAGGAAGCCAAGGTGATGATGAAACTGTCACATTCGAGGTTAGTTCAACTTTACGGGGTGTGTATA
CAGCAGAAGCCCCTGTACATAGTGACGGAGTTCATGGAGAACGGCTGCCTGCTTGACTATCTCAGGGAGA
GGAAAGGCCAGCTTCAGAAGGCGCTGCTCTTGAGCATGTGCCAAGACATATGTGAAGGGATGGCGTACCT
GGAGAGGAGCTGCTATATTCACAGGGATCTGGCTGCCAGGAACTGTTTGGTCAGTTCTGCCTGCGTAGTA
AAGATCTCAGACTTCGGCATGGCGAGGTATGTTTTGGACGATGAATATATCAGTTCTTCTGGAGCTAAGT
TCCCAGTCAAGTGGTGCCCACCTGAAGTCTTTCATTTCAACAAATACAGTAGCAAGTCTGATGTCTGGTC
GTTCGGAGTTTTAATGTGGGAAGTTTTTACAGAAGGAAAAATGCCTTTTGAAAATAAGTCAAATTTGCAA
GTGGTGGAAGCCATTTCTCAAGGTTTCCGGCTGTATCGTCCTCACCTGGCCCCCATGACCATATACAGAG
TGATGTACAGTTGCTGGCATGAGAGCCCTAAAGGCCGTCCGACATTTGCTGAGCTGCTTCAGGTTCTCAC
GGAGATCGCAGAAACGTGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289495
Insert Size 1422 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289495.1, NP_001276424.1
RefSeq Size 2277 bp
RefSeq ORF 1422 bp
Locus ID 22165
UniProt ID P42682
Gene Summary Non-receptor tyrosine kinase that plays a redundant role with ITK in regulation of the adaptive immune response. Regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. When antigen presenting cells (APC) activate T-cell receptor (TCR), a series of phosphorylation lead to the recruitment of TXK to the cell membrane, where it is phosphorylated at Tyr-420. Phosphorylation leads to TXK full activation. Contributes also to signaling from many receptors and participates in multiple downstream pathways, including regulation of the actin cytoskeleton. Like ITK, can phosphorylate PLCG1, leading to its localization in lipid rafts and activation, followed by subsequent cleavage of its substrates. In turn, the endoplasmic reticulum releases calcium in the cytoplasm and the nuclear activator of activated T-cells (NFAT) translocates into the nucleus to perform its transcriptional duty. With PARP1 and EEF1A1, TXK forms a complex that acts as a T-helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFNG to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production. Phosphorylates both PARP1 and EEF1A1. Phosphorylates also key sites in LCP2 leading to the up-regulation of Th1 preferred cytokine IL-2. Phosphorylates 'Tyr-201' of CTLA4 which leads to the association of PI-3 kinase with the CTLA4 receptor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses two alternate splice sites in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...