Vegfa (NM_001110335) Rat Untagged Clone
CAT#: RN200265
Vegfa (untagged ORF) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 4, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Vegf; VEGF-A; VEGF111; VEGF164; VPF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200265 representing NM_001110335
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTGCAGCATAGCAGATGTGAAT GCAGACCAAAGAAAGATAGAACAAAGCCAGAAAAAAAATCAGTTCGAGGAAAGGGAAAGGGTCAAAAACG AAAGCGCAAGAAATCCCGGTTTAAATCCTGGAGCGTTCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCAT TTGTTTGTCCAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGC AGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCAAGGCGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001110335 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001110335.1, NP_001103805.1 |
RefSeq Size | 2616 bp |
RefSeq ORF | 330 bp |
Locus ID | 83785 |
Gene Summary | This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. This variant has transcript support, but the protein is predicted. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200265 | Vegfa (Myc-DDK-tagged ORF) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 4, (10 ug) |
CNY 3,990.00 |
|
RR200265L3 | Lenti ORF clone of Vegfa (Myc-DDK-tagged ORF) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 4, (10 ug) |
CNY 6,080.00 |
|
RR200265L4 | Lenti ORF clone of Vegfa (mGFP-tagged ORF) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 4, (10 ug) |
CNY 6,650.00 |