Gpx4 (NM_001039849) Rat Untagged Clone

CAT#: RN200392

Gpx4 (untagged ORF) - Rat glutathione peroxidase 4 (Gpx4), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary)



  "NM_001039849" in other vectors (1)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Synonyms gpx-4; Gshpx-4; Phgpx; snGpx
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200392 representing NM_001039849
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCGCGCGGCCGCCCGCAAGCGGGGACGCTGCAGACAGCGCGGCCGGTCCCCGGGAGGCCGGCGAC
GGCGTGAACCTGGACGCCAAAGTCCTAGGAAGCGCCCAGGCCCTCGGAGGAGGAGAGCTCGCGCGCGCCG
CCGCAGGAGGGCGCGCCCTCGCCGGATGGAGCCCATTCCCGAGCCTTTCAACCCGCGGCCTCTGCTGCAG
GACCTTCCCCAGACCAGCAACAGCCACGAGTTCCTGGGCTTGTGTGCATCCCGCGATGATTGGCGCTGTG
CGCGCTCCATGCACGAATTCGCAGCCAAGGACATCGATGGGCACATGGTTTGCCTGGATAAGTACAGGGG
TTGCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACCGACGTAAACTACACTCAGCTAGTC
GATCTGCATGCCCGATACGCCGAGTGTGGTTTACGAATCCTGGCCTTCCCTTGCAACCAGTTCGGGAGGC
AGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAATGTCAGGTTTGACATGTACAG
CAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGG
GGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGA
AGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001039849
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039849.2, NP_001034938.1
RefSeq Size 1037 bp
RefSeq ORF 762 bp
Locus ID 29328
UniProt ID P36970
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 1, 10 and 14. [provided by RefSeq, Jan 2019]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon compared to variant 1. The resulting isoform (B, also know as snGPx) has a longer and a distinct N-terminus compared to isoform A. This isoform has been reported to be localized in the sperm nucleus (PMID:11344099). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...