Bcl2l1 (NM_001033670) Rat Untagged Clone
CAT#: RN200467
Bcl2l1 (untagged ORF) - Rat Bcl2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein, transcript variant 3, (10 ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | bcl-X; Bcl-xl; Bcl2l; Bclx |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN200467 representing NM_001033670
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTCTCCCAGAAAGGATACAGCT GGAGTCAGTTTAGCGATGTCGAAGAGAACAGGACTGAAGCCCCAGAAGAAACTGAACCAGAAAGGGAGAC CCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCCGCGGTGAATGGAGCCACTGGC CACAGCAGCAGTTTGGATGCGCGGGAGGTAATCCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCTG GCGATGAGTTTGAACTGCGGTACCGGAGAGCATTCAGTGATCTAACATCCCAGCTTCATATAACCCCAGG GACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTTCGGGATGGGGTAAACTGGGGTCGCATT GTGGCCTTCTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGA GTCGGATTGCAAGTTGGATGGCCACCTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGG CTGGGACACTTTTGTGGATCTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAAGGCCAGGAGCGTTTC AACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGTGTAGTTCTGCTGGGCTCACTCTTCAGTCGGAAGT GA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001033670 |
| Insert Size | 702 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001033670.1, NP_001028842.1 |
| RefSeq Size | 2393 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 24888 |
| UniProt ID | P53563 |
| Gene Summary | inhibits neuronal apoptosis; may provide neuroprotection against ischemic brian injury [RGD, Feb 2006] Transcript Variant: This variant (3) differs in the 5' UTR, 3' UTR, and 3' coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR200467 | Bcl2l1 (Myc-DDK-tagged ORF) - Rat Bcl2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein, transcript variant 3, (10 ug) |
CNY 3840.00 |
|
| RR200467L3 | Lenti ORF clone of Bcl2l1 (Myc-DDK-tagged ORF) - Rat Bcl2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein, transcript variant 3, (10 ug) |
CNY 6080.00 |
|
| RR200467L4 | Lenti ORF clone of Bcl2l1 (mGFP-tagged ORF) - Rat Bcl2-like 1 (Bcl2l1), nuclear gene encoding mitochondrial protein, transcript variant 3, (10 ug) |
CNY 6650.00 |
